Lago News September 2009
description
Transcript of Lago News September 2009
1
#6
LAGO NEWS SETTEMBRE 2009
Brochure settembre 01.indd 1 7-08-2009 9:58:41
L’Appartamento è una nuova visione sul futuro
L’Appartamento è un progetto Lago, nato dalla consapevolezza
che il design non deve guardare soltanto al singolo prodotto,
ma al miglioramento della vita e del lavoro delle persone.
Con questa idea in testa, abbiamo individuato un modo innovativo
di sostenerla economicamente.
L’Appartamento è una rete di case nelle quali le persone più
interessanti si incontrano e pensano a come riprogettare la vita
e il territorio. E’ uno spazio incredibilmente bello, progettato per
accogliere, lavorare, rilassare e far nascere le idee che disegneranno
il futuro.
Gli appartamenti sono nelle grandi città ma non solo: sono dovunque
ci siano fermento, energia e persone che hanno idee per cambiare
il mondo.
Tutti possono candidarsi per aprire un appartamento, viverci, lavorarci,
e farlo diventare un punto di riferimento in città.
L’Appartamento è un nuovo modello economico
Chi sa rendere speciale un Appartamento è il padrone di casa - il tenant
- che per un periodo decide di vivere in un Appartamento Lago.
Il tenant ha il compito di organizzare eventi, conoscere chi fa
innovazione nella sua città e sviluppare occasioni di networking, far
conoscere a più persone possibile il luogo dove vive. Per questo il
tenant che cerchiamo è una persona speciale, capace di coinvolgere,
promuovere, progettare, cogliere la sfi da.
Il tenant è Appassionato di design e sa tutto dei mobili Lago, per
questo ne è l’ambasciatore in città. Aprendo la propria casa aiuterà
altre persone nella progettazione e nella scelta di acquistare dei mobili
Lago, per poi indirizzarle ad un negozio di riferimento. In questa sua
attività il tenant è supportato da Lago che fornisce l’arredamento della
casa ad un prezzo agevolato, la formazione e gli strumenti necessari.
Forse vivere in un Appartamento non potrà diventare il tuo lavoro
principale, ma sarà un’ottimo lavoro integrativo.
Invia la tua candidatura su appartamento.Lago.it
Brochure settembre 02.indd 2 7-08-2009 10:37:56
Appartamento is a new vision over the future.
Appartamento is a Lago project, conceived through the awareness
that design in not only about the individual product, but also about
improving people’ lives and work environments.
With this in mind, we thought of an innovative way to support this
idea fi nancially.
Appartamento is a fl at where the most interesting people meet
and discuss about how to re-design, plan life and environments.
It’s a an extremely confortable and pleasant space where to welcome
people, work, relax and come up with ideas that will tailor the future.
These fl ats are located in big cities, but not only: they are everywhere
there is energy and people who have ideas which will re-defi ne the
world.
Everybody can apply to open up a Lago fl at (Appartamento), to live
and work in it, to make it become a melting pot for the city.
Appartamento is a new economic template.
The person who makes an appartamento special is either a landlord
or a tenant, who choses to live in a Lago fl at for a while. This person
has to organise events, to get in contact with people who are involved
with innovation within his/her city, to develop networking opportunities
and to introduce his/her fl at to as many people as possible. That’s why
we are looking for special people capable of attracting, promoting,
designing and taking the challenge.
The landlords/tenants is passionate about design and knows Lago’s
furniture well. He/she is the Lago’s ambassador in the city. By opening
the doors of his/her own fl at, he/she will help other people to design
their houses’ interior with Lago’s furniture and address them to the
nearest dealer. Lago supports the landlord/tenant by providing the fl at
furnishing at a special price, training and all the necessary tools.
Maybe living in an Appartamento may not become your main job,
but it could be a cool second job.
Please send your appllication to appartamento.Lago.it
APPARTAMENTOa place for re-designing life
Brochure settembre 03.indd 3 7-08-2009 10:44:17
Cucina/kitchen 36e8, tavolo/table Air, altalena/swing Softswing
Brochure settembre 04.indd 4 7-08-2009 10:19:51
5
Brochure settembre 05.indd 5 7-08-2009 10:36:39
Libreria/bookcase L/\goLII\IE/\, poltroncina/armchair Huggy
Brochure settembre 06.indd 6 7-08-2009 10:27:51
7
Brochure settembre 07.indd 7 7-08-2009 10:47:32
Scrivanie/desks Air, libreria/bookcase Air, contenitori/storage units 36e8
Brochure settembre 08.indd 8 7-08-2009 10:32:09
9
Brochure settembre 09.indd 9 7-08-2009 10:23:05
Letto/bed Air, comodino/bedside table 36e8, armadi/wardrobes N.O.W.
Brochure settembre 10.indd 10 7-08-2009 10:28:42
11
Brochure settembre 11.indd 11 7-08-2009 10:20:38
Letto/bed Fluttua, libreria/bookcase 30MM, cassettiera/drawers unit Morgana, poltroncina/armchair Huggy
Brochure settembre 12.indd 12 7-08-2009 10:45:16
Brochure settembre 13.indd 13 7-08-2009 10:27:20
Libreria/bookcase L/\goLII\IE/\
Brochure settembre 14.indd 14 7-08-2009 10:43:32
15
Bagno/bathroom 36e8
Brochure settembre 15.indd 15 7-08-2009 10:42:57
36e8 Cucina
L. 478,5
H. 204,1
P. 27/40,6
61/67
Tavolo Air
L. 250
H. 76
P. 100
L/\goLII\IE/\
L. 392
H. 214,8
P. 24,8
36e8
L. 294,4
H. 133,8
P. 27/40,6
Softswing
L. 56,8
H. 6
P. 28,8
L/\goLII\IE/\
L. 85,6
H. 204,4
P. 24,8
36e8
L. 220,8
H. 93,7
P. 40,6
Softbench
L. 129,5
H. 43,9
P. 40,2
Settimanale
Morgana
L. 60
H. 138
P. 45
36e8+30MM
L. 282
H. 202,4
P. 24,8/27
Tavolo Air
L. 160
H. 76
P. 85
Frigo Freestading
L. 61
H. 155,6
P. 61
Huggy
L. 130
H. 78
P. 80
36e8+30MM
L. 478,4
H. 239,2
P. 24,8/27/40,6
Armadio N.O.W.
L. 116,5
H. 290
P. 61
Letto Air
160x200
36e8-Comò
L. 147,2
H. 18,4 (55,2 da terra)
P. 40,6
Libreria Air
L. 184,0
H.155,7
P.40,6
Comodino Morgana
L. 60 H.
H. 66,1 (con ruote)
P. 45
N.O.W.
Colonna
cucina
L. 315,3
H. 227,0
P. 67,0
Letto Fluttua
160x200
Georgi
Manassiev
Multifunctional
nails
Appendiabiti
Georgi
Manassiev
Plate
Piatto
Harry Thaler
One Barrel light
Lampadario
Hwang Kim
The Cocoon -
Portable urban
shelter for a home-
less'
Rifugio urbano
portatile per
senzatetto
Ilgu Cha
Trace of
Time
Orologio
Krystian
Kowalski
Giraffe
Sgabello
Nicola Zocca
Harry Thaler
Compressedairbike
Bici ad aria
compressa
Seongyong
Lee
Color space
Libreria
Yuya
Kurata
Edison’s
Exuviae
Candela
Abitanti dell’Appartamento
16 17 18 19 20 2112 13 14 15
1
2
4
5
6
7
8
9
10
11
3
2122
23
11
12
14
15
1718
19
20
Brochure settembre 16.indd 16 7-08-2009 10:27:40
17
36e8 Totem
L. 73,6
H. 220,8
P. 27
36e8 Bagno
L. 257,6
H. 177
P. 27/52
Pontaccio
L. 100
H. 38
P. 18+24
Armadio
N.O.W.
L. 185,5
H. 265
P. 61
L/\goLII\IE/\
L. 235,8
H. 222,5
P. 24,8
36e8+30MM
Comò
L. 245,2
H. 184
P. 24,8/40,6
30 MM
L. 42,8
H. 184
P. 24,8
Letto Fluttua
100x200
Letto
Justmat
100x200
Armadio
N.O.W.
L. 185,5
H. 265
P. 61
Seongyong Lee
ONIV
Vaso portacandele
Seongyong
Lee
Shade Light
Lampada
ShiKai
The Door
Lampada
porta
Valentin
Vodev
Radio
Valerie
Radio
Yiting Cheng
Sean Yu
Wall clock
Orologio da
muro
Yiting Cheng
Sean Yu
Neon light
trap
Neon
Yuya Kurata
Lion Door
Knocker +
Hook
Battiporta
appendiabiti
Valentin
Vodev
Soft Flexible
Lamp
Lampada
Tien Sheng
Lighting Dryer
Lampada
asciugatrice
Nicola
Zocca
Bill light
Lampada
22 23 24 25 26 27 28 29 30 31
16
8
9
24
25
29
30
31
2
3
4
5
7
10
13
1626
27
28
Brochure settembre 17.indd 17 7-08-2009 10:44:37
LAGO HOMESMelting Architecture with Design. Experimental Projects by Fram_menti Architecture Studio
Una storia, una vita, un modo di usare lo spazio
che ci sta attorno… ognuno di noi vive lo spazio
dell’abitare in modo unico, irripetibile. I prodotti
LAGO contengono la possibilità di dare un’immagine
a questa unicità. Da qui l’idea di LAGO HOMES,
per dare una forma unica alla propria casa,
sperimentando soluzioni che fondano architettura
e design. Ogni casa diventa una storia, i prodotti
diventano i mattoni con cui costruire questa storia,
con cui fare architettura. Il progetto LAGO HOMES
segna l’inizio di una sperimentazione e nel contempo
riassume lo spirito LAGO, gli ingredienti della nostra
passione, del nostro lavoro attorno a ciò da cui non
possiamo prescindere: HOME.
One story, one life, one way to use the space
surrounding us: each of us live his/her living space in
a unique and unrepeatable way. The LAGO
products contain the possibility to offer a picture of
such uniqueness. Hence the idea of LAGO HOMES,
in order to give an outstanding shape to people’s
home, experimenting solutions which melt
architecture with design. Each home becomes a
story, and the products become the bricks
with which people build their story, with which they
can make architecture. The LAGO HOMES project
marks the beginning of a testing process and, at
the same time, summarizes the LAGO spirit, the
ingredients of our passion, of our work on this and
from which we cannot do without: HOME.
1
2
hOMe
Prodotti utilizzati: Air, Now.
Product used: Air, Now.
Having Only More Earth
Prodotti utilizzati: 36e8 cucina,
36e8 e Now.
Product used: 36e8 cucina,
36e8 and Now.
1
2
Brochure settembre 18.indd 18 7-08-2009 10:20:13
19
1
2
Brochure settembre 19.indd 19 7-08-2009 10:33:58
36e8
Basato su un modulo da 36,8 cm x 36,8 cm questo
sistema dona allo spazio forma e sostanza creando
volumi di differente lunghezza da accostare gli
uni agli altri con innumerevoli opportunità di
contenimento.
Con 36e8 tutti possono diventare i designer
del proprio spazio. Come? Accostando i moduli
36e8 per disegnare la composizione che soddisfa
maggiormente gusto e necessità.
Based on a 36.8 cm x 36.8 cm module, this system
gives space a form and substance by creating
volumes of different lengths that can be matched
together in endless combinations.
36e8 means that everyone can design their own
home spaces. How? 36e8 modules can be mixed
and matched to design compositions meeting every
taste and requirement.
1
36e8: comp. 150
Contenitori in vetro lucido
kaki, verde acido e in vetro
opaco bianco.
Kaki, verde acido polished
glass and bianco opaque glass
storage units.
L 404,8 H 222,5 P 27/40,6/56
Prezzo a partire da/Price from
€ 5.076
1 36e8: comp. 164
Contenitori in vetro lucido
grafi te, aragosta, mandorla,
salvia, sole, verde acido,
bosco e fumo.
Grafi te, aragosta, mandorla,
salvia, sole, verde acido,
bosco and fumo polished
glass storage units.
L 368 H 202,4 P 27/40,6/56
Prezzo a partire da/Price from
€ 4.140
2
Tutti i prezzi indicati si intendono escluso progettazione, trasporto e montaggio. All given prices exclude design, transport and assemblage.
Brochure settembre 20.indd 20 7-08-2009 10:44:47
21
2
Brochure settembre 21.indd 21 7-08-2009 10:28:10
36e8: comp. 171
Contenitori in vetro lucido
bianco, amaranto e in vetro
opaco nero.
Bianco, amaranto polished
glass and nero opaque glass
storage units.
L 368 H 211,6 P 27/40,6/56
Prezzo a partire da/Price from
€ 4.945
36e8: comp. 173
Contenitori in vetro lucido
bianco, paglia, spago e sole.
Bianco, paglia, spago and sole
polished glass storage units.
L. 515,2 - H. 167,3 - P. 27/56
Prezzo a partire da/Price from
€ 6.286
36e8: comp. 152
Contenitori in vetro lucido
bianco.
Bianco polished glass storage
units.
L 368 H 220,8 P 40,6
Prezzo a partire da/Price from
€ 4.424
1
2
3
1
2
3
Tutti i prezzi indicati si intendono escluso progettazione, trasporto e montaggio. All given prices exclude design, transport and assemblage.
Brochure settembre 22.indd 22 7-08-2009 10:24:49
23
30MM
Non importa dove importa come
30MM è l’esile spessore dei fi anchi di questo
nuovo sistema di librerie LAGO che grazie ad
uno speciale attacco a muro può essere fi ssato
a parete e anche sospeso. Questa versatilità
consente di creare composizioni fantasiose come
alberi, nuvole, forme astratte, semplici o eleganti.
Il sistema 30MM è disponibile anche con fi anchi e
ripiani di spessore 50mm e 80mm.
30MM - LAGO’s new slim line bookshelf system
that, thanks to a special wall-mounting system,
can be secured to or suspended from walls.
Such versatility can be exploited to create
imaginative compositions such as trees, clouds,
abstract, simple or elegant shapes.
The 30MM system is also available with sides and
tops in 50mm and 80mm thicknesses.
1
2
30MM: comp. 303
Laccato bianco, sole, paglia,
avio. Schienali vetro lucido
fumo, sole, paglia, avio.
Lacquered bianco, sole,
paglia, avio. Polished glass
back fumo, sole, paglia,avio.
L. 386 - H. 266,8 - P. 24,8
Prezzo a partire da/Price from
€ 2.704
30MM: comp. 305
Laccato bianco.
Schienali vetro lucido cocco,
mandorla, spago, panna.
Lacquered bianco.
Polished glass back cocco,
mandorla, spago, panna.
L. 386 - H. 202,4 - P. 24,8
Prezzo a partire da/Price from
€ 2.987
1
2
Brochure settembre 23.indd 23 7-08-2009 10:30:14
L/\goLII\IE/\
1
The L/\goLII\IE/\ system has a slim and simple
design, conceived to offer maximum freedom when
designing wall compositions. Its what is left after
reducing a common grid bookshelf.
The essence of L/\goLII\IE/\ is a practical, minimalistic
solution to storing books, audio visual and
accessories. Unique shapes can be created to tell a
personal story.
The L/\goLII\IE/\ systems simplicity in it basic
materials brings aesthetic value and combines
innovative ideas which are price accessible.
From now on, everybody will be able to express
themselves through lines ;-)
Tutti i prezzi indicati si intendono escluso progettazione, trasporto e montaggio. All given prices exclude design, transport and assemblage.
Il sistema L/\goLII\IE/\ è un segno grafi co snello e
leggero, progettato per offrire ad ognuno la massima
libertà espressiva a parete, è ciò che è rimasto
riducendo al minimo la classica libreria a griglia.
E’ l’essenziale in termini di utilità pratiche ed
emozionali, il necessario per riporre libri, televisore,
oggetti, è un modo originale per raccontare una
storia con un gesto.
Il sitema L/\goLII\IE/\ trasforma la riduzione di
materiale in valore estetico, riuscendo a far diventare
una libreria innovativa leggera anche nei costi.
Da oggi qualsiasi persona potrà disegnarsi a grandi
linee ;-)
Brochure settembre 24.indd 24 7-08-2009 10:43:58
25
L/\goLII\IE/\: comp. 312
Laccato bianco.
Lacquered bianco.
L. 361,6 - H. 190,4 - P. 24,8
Prezzo a partire da/Price from
€ 2.617
L/\goLII\IE/\: comp. 324
Laccato nero, fumo, grafi te,
mandorla. Frontali ante vetro
lucido nero, fumo, grafi te,
mandorla.
Lacquered nero, fumo, grafi te,
mandorla. Polished glass door
fronts nero, fumo, grafi te,
mandorla.
L. 337,2 - H. 211,6 -
P. 24,8/27/40,6/56
Prezzo a partire da/Price from
€ 3.222
L/\goLII\IE/\: comp. 322
Laccato rosso, lilla, kaki, verde
acido, amaranto, avio, prato,
salvia, sole.
Lacquered rosso, lilla, kaki,
verde acido, amaranto, avio,
prato, salvia, sole.
L. 248,2 - H. 211,6 - P. 24,8
Prezzo a partire da/Price from
€ 1.765
L/\goLII\IE/\: comp. 329
Laccato bianco, paglia, spago,
avio, grafi te. Frontali ante
vetro lucido spago, avio,
grafi te, paglia.
Lacquered bianco, paglia,
spago, avio, grafi te. Polished
glass door fronts verde acido,
kaki, sole, lilla, paglia.
L. 343,2 - H. 184 -
P. 24,8/27/40,6/56
Prezzo a partire da/Price from
€ 3.099
1
2
3
4
4
2
3
Brochure settembre 25.indd 25 7-08-2009 10:46:37
L/\goLII\IE/\: comp. 319
Laccato salvia, verde acido,
prato, bosco, castagno.
Lacquered verde acido, prato,
bosco, castagno.
L. 378,1 - H. 244,3 - P. 24,8
Prezzo a partire da/Price from
€ 2.838
Tutti i prezzi indicati si intendono escluso progettazione, trasporto e montaggio. All given prices exclude design, transport and assemblage.
Brochure settembre 26.indd 26 7-08-2009 10:23:55
Pooinntt SSpppppppppaaaaaaaaaaaaccccccccccccccccccceeeeeeeeeeeeeeeeeeeeeeeeeee SSSSSSSSSttttttttooooooooooooooooooooorrrrrrrrrrrrrrrrrrrrrrrrrrrrreeeeeeeeeeeee
PoP ininininininnnnnnt,ttttttttttt PPPPPPPPPPPPPPPPPPPoioioioioioioioioooiooiooioioi ttntntntntttntnttttntntntntttntnt XXXXXXXXXXXXX XXLLLLL,L,LLL,L,L,LL,,L,, SSS SSSSSSSSSSSSSSpapapapapapapapaapppppppp cecececececececececececececee, Space e XLXXLXLXLXLXLXLXLLLLXL, , , , StStStSSSS orororrre…e…e…ee…e…e
ququessssssstitititittitit s ssonono o ooo iiiii i i nononononononoonoststststttttststttttttttrriiiiririririirirrr ppara tnerr. .. ... QQQQQuQuQuQQQuuQ esesesese titititiitti
sonon i negge ozozzi i chchche hahannno o o innininininninnnsisisisiemememme e e eee a a a nonononnnnoiiii
abababa bbbbbrbbbrrbrraaaaacaccacaca ciciciiatataattatoo o o unununun pp p p pprororoorooogegegeggegegegegggggg ttttttttttto ooooo dddiddii rrr iinnonovvavv mentntnn o oabbracciatoo un progettttttttttttttttt ooooo didid rrrinininnononoovavavavamememementntntntn oooooo
prprprprpprprpprprpprprprpp opopopoooopopopopopopoppoopppoo ooooooonononononoonooonnooo enenenenenenenenndododododododoodo u u u u uuuuuunnnnnnnnnn n nnnn nn n nnnnnnnununununununnnnunnnuovovovovovovovovo ooooooo oo o cococococococococoocoocococococooncncncncnccncnccccncn eetetettoto d ddddddi casasass
LAAAAAALALALAALAALALALAALALALALAALLAALALALALLLALAAALLAALAAAAGOGOGOGOGOGOGOGGOOGOOGOOGOOGOGOOGGGOOOG . .. . NoNoNoNoNoNoNoNoNNoNNooNoNNoNoooNoNoNoN nnn n nnn nnn sosososososososololololololololooooo dddddd d ddd d dddddddeieieieieieieieieieieeie ff f fff ffororororrorororoorrmmammmmmmamaammammmmmmmaaaam ttttt t ttttttt esespopopopopop sitiivivivivi
dddoddododooooddoooooodovevevevevevvvevevevevvevveevvvv p pp pppppp pp potototototototototottototto ereeeereerererererererererereerererr t tttttttt tttttttrororororororoorrrorooovavavavavavavvavavarerererereree l l l l lle e e e e eeee nonnonoonononnnossstsstststststttttssttssttttrererer ppprororrorr poststtte e mammaaa
uuuununununnnnuuunna aaaa aa a aaaaa rererreeeereeererretetetetetetetettetee d d d d dddddddi ii i iii pepepepepepeppersrsrsrsrsrsrrsononononononnnnnnonne eeeeeeeeeeeeeeeeeeeeeeeeee ccchcchchcchchhchcccccccccchhcchche ee eee eee ppopopopoppp rtrtrtrtaananaa o i nonnonoststttriririririi
vavavavavaaaavvaavv lolololooooooooolooooririririiririiiirrr a aa a aaaallllllllllll’i’i’’i’i’iintntntntnntntntererererereere nonononononoooo d d ddddddddeleeleleleleleleleleleeeleleeeeeeeele leeleeleleeleeeleleleleeleeleleeelelleelelle v v v vvvvvvvvvvvvvvvvvvvoosososoooo trtrtrtre e eee casesee, ,, cocoooonnnn
prprprpprrrpprproofoooofofofooofofffofeseeeeessssseeeeeeeessisisisisisisiononononoonoonnonnalalalallalititittitttà àà à à à ààààà ee e e e eee cococococococooocoocooooompmpmpmmmpmpmpmpppmpmppppmppmpmpppppmmppppmpppppetetetettenenene zazzz .
DaDDDDaaaaaDaDaDaa llll lloororooorrorooooroo o oo o o oo popopopopopopopopoopoopopooopopop trtrtrtrtrtttrttrtrtrttrtrrrrtrttrtraiaiaiaiaiaiaiaaaiaiaiaiaaaai t t tttt ttrororororororoorovavavavavavaaavaarererererererereerereereeeeeeereeereeee nn n nnnnnnuouououou vevvvv ideeeee eee e e spspspss untii
prpprrpprrrp oogogogogogoggogoooogeeeeteteteteteteteete tutututututututuualalalalalalaliiiiiiii i crcrcrcrcrccrcrrrcrcrcrccrcrc eeaeaeeaeaeaeeaeaeaeaeeaeaeaae tetetetetetteteeteteteeeteteete a a a aaaaaaaappppppppppppppppppppppppppppppppppppppppppppppppp osooososoooo tatatatatat per t tttttttttttte eeee eeeeeee eeee eeeee eeeeeeeeeeeeeeeeeeeeeeeeee eee ee e pepeppepppepepeppeppepepeppppppepepeppppeppepepepepepepeepeeepppppppppp rrrrrrrrrrrr r rrr llalaalallalalalaa
tututuuuuuuaaaaaa aaaaaa cacacacacacacaccaaaaacac sasasasasasasassas ...
PePeeeeeeePPeer rrr rrrrrrrr vivivivivivivivivvivivv susususususuusususualalalalalalala izizizizizzizzizii zazazazazazazazazzazz rerererererereeere i i iiiiiiii n n nn n nnn negegegegegegeggggggegggggeggggozozozozozozozozozozozozziiiiiiii iiiii i ii pipippipippippipipipipppppppppp ù ù ù ùùùù viviviviviviviviviviiviviviivvvivvviivvivvivvvvvvviv cicccciccccccccccccccccc nnnnnnnininininninnninnnn aa vvvvvvvooioiiioiioiooiooooooooo
clclllc iciciciciccccicccccccacacacaacacaaaacacaacateteteteteteteeee s s sssssu u u u uuu uu wwwwwwwwwwwwwwwwww w.w.w.w.w.ww.w.LaLaLaLaLaLaLaaLagogoogogogogoo.i..iii.ii.iiii.itttt ttt ttttt ---- ---- neneneneneneneeeeeegggggggogogogogogogogogoggggogoggggggggggg ziziiiiiiiziziii
PoPoPoPoPoPoPPoPPPoPPPoPoPoPPoPoPoPPPoPoPoPooPooP innnnnii t,,,,, P P P PPPPoioioioioioiooio ntntntntntntntntn XXX XXXX XXXLLLLL,LLL, SSSpapaaacececee, , , , ,, SpSpSSpSSSpSS acacacee e ee eeee XLXLLXLLLLLLLLL, , StStStttttttSttororore.e.e
ThThhhhThesesesseseesese ee ararrre e e ouououououoouo r rrrrrrr papapapapaappap rtrtrtrtrtttneneneenersrsrssrs. . ThThTTTTTT ese eee e ee aaararaare e e thhhtheeeee
shshshhhhshshshshshhhshopoopopopopooops s s s whwhwhwhwhwhwhwho o o ooooo hahahahahahaavevevevevevvvv e e eeeembmbmbmbmbm rararararaceceeeeed,d, tttttogoogogogggeteteeteee heheherrrrrrrrrrrrrr
wwiiiiithththhtht uuus,s,ss,s, a a aaaa r rr rrrenenenenennovovovovovovvatatatatatatioioioioioon n nnn pprpppp ojojoooojoo ececect,,,t,t, b by yyy y
prrrrrrropopoopopopososososssinininininnnng g g g g g a a aa aaa nenenenenenew w w wwww cococococoncncncncn epeepppeppeppt ttt ofoof tthehe L LLaggggoooo
hoooohhohooomememeemm . . . NoNoNoNoNoNoot t tttttt onononononono lylylylyyyly e e eee exhxhxhxhxhibibibibibitititititiitiooioiooooioon nnnnn fof rmrmmataaattatatttts ss whwhwhwhwwhwhwhwhwhwwhwwwhwhw ererereree
itit iis ssss popopoosssssssssssibibibibbibbblllellllee ttto o fiffiinddndn oourur p ppppproopopopp sasasaasasasals, bubububub t ttt
alalssssososos aaaaaa nnnnnettetetetetetete wowowowowowwwooworkrkrkrkkrkrkrkrkk o ooo ooooof f ff fffff pepepeppepepeopopopopleeleeeelel w wwhohoohoh b b bbbrrrrirrr ng
ouuuuuuuuur r rrr vaaalululuueseseses i i iiinsnsnsnssnsn ididididide e e e ee yoyoyoyoyooururururur h h h h hhomooooomoo esesesse , , wwwiwwww th
prprrrrrrrrrofoofofoofoo esessssisisisisiss onononononalalalalal sisisisissm m m mmmm ananananand d d ddd exexexexexeexpepeeeeertissisee.e.eee. T TTTTThhehhhh reeeee y yyouououu
wiiiiw llllllll bbbe e e e ababababbablelelelele t t ttt to o o o o o fififififif ndndndndndndn n n nnnewewewewewewe iiiiiiiiidedddded asassasasas a aaanndnnn clullul eseses
onnnnnnnnnnon hhhhowowowowww t t tttto o oooo plplplplplplp anananananan a aa a aa c c cccccususususuustototototototom-mm-mm-mm mamaaaamadedededede hhhommme e fofoffor rrrr
yoyoooyooooooyoou.uu.u.uu TTTTTo o sesesee ee ththt e ee clcclc ossossesesesee t ttt shsshshshshhsss opopopoppps ss ss s ss ccclcc icck oononnnn
wwwwwwwwwwwwwwwww.w.wwww LaLaLaLaLaLaLaLagogogogogogogogo.i.i.iiiiiitt tt t tt - - - shshshshshhshshhshopopopopoppoopssssssss
Opening soon: Lago Store Bilbao, Valencia, Lione, Leeds, Amiens, Colonia
Brochure settembre 27.indd 27 7-08-2009 10:47:55
36e8 CUCINADesign Daniele Lago
Nasce la cucina non cucina 36e8 cucina è un progetto che alleggerisce la
percezione di ingombro e pienezza delle cucine viste
sino ad oggi; l’approccio progettuale è totalmente
rivoluzionario: nasce la cucina-non-cucina che si
sgancia dai rigidi schemi compositivi e consente di
creare volumi e forme sorprendenti.
Questa innovazione dà voce alla “quarta dimensione
del progetto” che è in grado di evocare alberi,
nuvole, aragoste, etc…
I contenitori, posizionabili orizzontalmente e
verticalmente, possono essere composti in modo
infi nito su un’ipotetica griglia (36,8cm x 36,8cm)
che lascia libertà di composizione, tenendo equilibri
formali eccellenti.
Agli ambienti domestici, spesso sovraccarichi di
oggetti dalle elevate prestazioni tecnologiche, LAGO
crede invece nel bisogno di più amore, armonia
e calore. L’innovazione semiotica della “quarta
dimensione”, pur essendo accattivante, garantisce
risposte eccellenti in termini di praticità e funzionalità
senza dimenticare che la funzione primaria rimane
cucinare.
1
The 36e8 cucina project today takes a lighter
approach to perception, overall dimensions and
solidity for kitchen suites; this design approach is
totally revolutionary: our kitchen-non-kitchen suites
break away from rigid outlines and modularity to
create astonishing volumes and forms.
This innovation expresses the “fourth project
dimension” to evoke trees, clouds, lobsters, etc…
Storage units can be positioned horizontally or
vertically and combined in infi nite ways around a
hypothetical grid (36.8cm x 36,8cm) ensuring both
design freedom and excellent formal composition.
Household settings are often over-loaded with
high-tech devices - yet LAGO on the other hand
believes that more love, harmony and warmth are
essential. The semiotic innovation of the “fourth
dimension” is both very attractive and also ensures
excellent responses in practical and functional
terms without forgetting that the primary function is
“cooking”. The 36e8 kitchen suites system develops
around three macro areas: N.O.W bases, wall units
and cupboards.
Tutti i prezzi indicati si intendono escluso progettazione, trasporto e montaggio. All given prices exclude design, transport and assemblage.
Winner of the Good Design Award 2009
Brochure settembre 28.indd 28 7-08-2009 10:33:19
29
1
36e8 Cucina: comp. 200
Laccato kaki, prato, bianco,
bosco, salvia e castagno
con top “Laminglass” e ante
in vetro lucido.
Lacquered kaki, prato, bianco,
bosco, salvia and castagno
with “Laminglass” top and
door panels in polished glass.
L. 460 - H. 240,4 - P. 40,6/67
Prezzo a partire da/Price from
€ 9.400 (Elettrodomestici e
dispensa esclusi/ Appliances
and storeroom excluded)
Dispensa N.O.W.
Laccato prato, bosco,
salvia e castagno con ante
in vetro lucido.
N.O.W. Storeroom.
Lacquered prato, bosco,
salvia and castagno with
door panels in polished glass.
L. 294,8 - H. 227 - P. 67
1
2
2
1
Brochure settembre 29.indd 29 7-08-2009 10:34:23
36e8 Cucina: comp. 209
Laccato aragosta con top
“Laminglass” e ante in vetro
lucido. Dispensa N.O.W.
Laccato kaki, nero e bianco
con ante in vetro lucido.
Lacquered aragosta with
“Laminglass” top and door
panels in polished glass.
N.O.W. Storeroom.
Lacquered kaki, nero and
bianco with door panels in
polished glass.
L. 441,6 - H. 202 - P. 40,6/67
Prezzo a partire da/Price from
€ 6.410 (Elettrodomestici e
dispensa esclusi/Appliances
and storeroom excluded).
Touch System
Ovviato il problema delle
impronte di farina su pensili
e cassettoni da aprire
eseguendo acrobazie circensi.
È suffi ciente utilizzare testa,
gambe, gomiti, ginocchia
et voilà!
The Touch System helps you
in bad moments. How to open
a wall-cabinet after kneading
pizza? just a masterstroke!
How to pick up the knife from
the drawer while cleaning
the fi sh? You only need a
knee (pay attention to your
kneecap, by the way).
Tecnologia nascosta
Andando un po’
controcorrente, abbiamo
deciso di privilegiare armonia,
calore e forme piuttosto
che proporre un ambiente
sovraccarico di tecnologie.
La soluzione?
Le abbiamo nascoste.
Lavastoviglie, cappa, forno,
frigorifero, congelatore sono
ospitati e protetti all’interno
dei moduli.
Clean design hides
technology. The whole project
aim to lighten the perception
of the ordinary kitchen.
Usually cumbersome and full
of things. We prefer balance,
colour, warmth, clean shapes.
That’s why used all of these
solution to keep technology
in hiding. Fan and dishwasher
are hidden into 36e8 cabinets.
Oven, fridge and freezer are
embraced by the N.O.W.
cupboard instead.
2
3
4
1
4
3
2
Dispensa N.O.W.
Trasferisce in cucina tutti
i plus della zona notte.
Sostituisce la dispensa-
vano elettodomestici con
un vero e proprio armadio
da top di gamma, con
guadagni in termini di
robustezza, risparmio di spazi,
confi gurabilità, semplicità di
forme, qualità delle fi niture e
molteplici opzioni di apertura
dei vani.
Move to the kitchen all the
features from the bedroom.
Plays the role of cupboard
and contains all the
electric devices (apart from
dishwasher), but still keeps
his identity of high quality
wardrobe: is tough as anyone
else, saves more space due to
his special modularity, same
high quality fi nishes of our
successfull wardrobe , clean
design and many different
opening systems.
1
Brochure settembre 30.indd 30 7-08-2009 10:38:14
31
36e8 Cucina: comp. 204
Laccato sole e blu oltremare
con top “Laminglass” e ante in
vetro lucido, frigo free-standing.
Lacquered sole and blu oltremare
with “Laminglass” top and
door panels in polished glass,
free-standing refrigerator.
L. 441,6 - H. 195 - P. 40,6/67
Prezzo a partire da/Price from
€ 6.496 (Elettrodomestici
esclusi/Appliances excluded).
36e8 Cucina: comp. 217
Laccato bianco con top
“Laminglass” e ante in
vetro lucido e dispensa.
Lacquered bianco with
“Laminglass” top and
door panels in polished
glass and storeroom.
L. 386,4 - H. 202,4 - P. 40,6/67
Prezzo a partire da/Price from
€ 6.323 (Elettrodomestici
esclusi/Appliances excluded).
36e8 Cucina: comp. 215
Laccato rosso con top e ante
in vetro lucido, dispensa.
Lacquered rosso with top and
door panels in polished glass,
storeroom.
L. 220,8 - H. 93,2 - P. 137
(Isola/Island)
Prezzo a partire da/Price from
€ 14.777 (Elettrodomestici
esclusi/Appliances excluded).
1
2
3
2
3
1
Tutti i prezzi indicati si intendono escluso progettazione, trasporto e montaggio. All given prices exclude design, transport and assemblage.
Brochure settembre 31.indd 31 7-08-2009 10:32:44
Leggerezza estrema
Un nuovo trio di prodotti, libreria, tavolo e letto che
inverte l’ordine dei fattori: leggerezza estrema nelle
strutture portanti, in cristallo trasparente e fi sicità
piena del piano e delle mensole. Il risultato è che
mensole, piano del tavolo e letto fl uttuino nell’aria,
quasi fossero sospese nel vuoto.
A new product “trio” - a bookshelf, table and bed
reversing the order of factors: extremely light
load-bearing structures, in transparent crystal glass,
and very solid tops and shelves. The result is that
the shelves, table top and bed seemingly fl oat on air,
almost as if suspended in a vacuum.
AIR
1
2
Letto AIR
Testiera in pelle bianca.
Pianale in HPL sorretto da
un telaio metallico fi ssato
su 4 lastre di vetro Starphire
extrachiaro rettangolari.
AIR Bed
Leather headboard.
HPL platform supported
by a metal frame attached
to 4 extra clear rectangular
Starphire glass plates.
180x200 - H. 29-71 o/or 39-81
Prezzo a partire da (mat. escl.)/
Price from (matt. excl.)
€ 2.340
1
Tutti i prezzi indicati si intendono escluso progettazione, trasporto e montaggio. All given prices exclude design, transport and assemblage.
Letto AIR
Testiera in pelle nero.
Armadio N.O.W. con ante
scorrevoli e fi anchi in vetro
lucido salvia, nero, avio,
fumo, lilla, grafi te. Cassettiere
MORGANA laccato avio e lilla
con frontali in vetro.
Comò 36e8 laccato nero.
AIR bed
Black leather headboard.
N.O.W. wardrobe with sliding
doors and sides in salvia,
nero, avio, fumo, lilla, grafi te
bright glass. MORGANA
chest of drawers, avio and lilla
lacquering with glass fronts.
Black lacquered 36e8 chest
of drawers.
Letto/Bed 180x200
Armadio/Wardrobe N.O.W.
L. 287,3 - H. 265 - P. 66,7
MORGANA
L. 60 - H. 54 - P. 45,3
Comò/Chest of drawers
L. 147,2 - H. 552 - P. 40,6
2
Brochure settembre 32.indd 32 7-08-2009 10:17:25
33
4
3
5
AIR: comp. 80
Laccato bianco.
Bianco lacquering.
L. 522,8 - H. 239,7 - P. 441,6
AIR: comp. 75
Laccato bianco.
Set vetri porta DVD.
Bianco lacquering.
Glass set, DVD player holder.
L. 310,4 - H. 249,7 - P. 40,6
Prezzo a partire da/Price from
€ 3.312
Tavolo AIR
Rovere grigio HP.
AIR Table
HP Grey oak.
L. 250 - P. 100 - H. 76
Prezzo a partire da/Price from
€ 1.953
3
4
5
Brochure settembre 33.indd 33 7-08-2009 10:20:59
Una “rete” di cubi
Un cubo, due cubi, una “rete” di cubi da 40
centimetri per lato si incontrano e si combinano
offrendo ad ognuno l’opportunità di creare una
libreria a propria immagine e somiglianza.
NET allarga i confi ni della creatività, e non teme
i limiti spaziali adattandosi con facilità alle situazioni,
dividendo aree e creandone di nuove.
Uno dei suoi punti di forza è il perno di congiunzione
verticale tra un cubo e l’altro: questo consente
la rotazione di ogni singolo elemento.
E così, una composizione lineare e ordinata
può diventare sinuosa e dinamica.
A single cube, two cubes, a “network” of cubes
measuring 40 centimetres per side mix and match
to offer everyone the chance to create bookshelves
with a truly personal touch.
NET expands the boundaries of creativity by
overcoming spatial limitations and easily adapting
to different situations to share existing and create
new spaces. One of its selling points is the vertical
pin between each of the cubes: this means that
every single element can be rotated.
Which in turn means that linear and orderly
composition can become sinuous and dynamic.
NET
1
NET: comp. 52
Laccato bianco.
Bianco lacquering.
L. 527 - H. 281 - P. 299
1 cubo laccato bianco prezzo
a partire da/1 single cube,
bianco lacquering price from
€ 290
1
Tutti i prezzi indicati si intendono escluso progettazione, trasporto e montaggio. All given prices exclude design, transport and assemblage.
Brochure settembre 34.indd 34 7-08-2009 10:36:09
35
Kids bedrooms
Gli stessi “ingredienti” che hanno caratterizzato
gli altri ambienti della casa, ovvero i prodotti LAGO,
si amalgamano creando ambientazioni più fresche,
più vivaci e vicine a quella fase della vita in cui tutto
è gioco. La giovinezza. Una fase in cui è ancora lecito
“volare” con la fantasia: è così che l’armadio di un
bambino diventa un grande pesce rosso. È così che
un serpente si insinua nella stanza. È così che una
fi ammante Ferrari si materializza sulla parete.
Un design a misura di bambino e non a misura
d’uomo: ecco la nuova ricetta.
The same “ingredients” characterising LAGO’s
renowned products for other home settings now
blend to create even fresher and livelier atmospheres
for the time of life when everything is playtime. Kids!
An age where “fl ights of fantasy” are so important:
which is why our wardrobe for kids resembles a
huge goldfi sh. Or a snake swirling into the bedroom.
Or a bright red Ferrari materialising on the wall.
Design for kids - not for adults:
this is the new approach.
2
1
1
2
Letto FLUTTUA
Letto singolo con testiera
in ecopelle col. 608 e
illuminazione sottorete.
Armadio N.O.W. con ante
scorrevoli e fi anchi in vetro
lucido nero, sole, rosso e
bianco. Tangram laccato
rosso e sole.
FLUTTUA Bed
Single bed with headrest
ecological leather col. E608
and underframe lighting.
N.O.W. wardrobe with sliding
doors and sides made of
polished glass in the colours
nero, sole, rosso and bianco.
Tangram rosso and sole
lacquered.
Letto/Bed 100x205
Armadio/Wardrobe N.O.W.
L. 187,3 - H. 265 - P. 66,7
Tangram rosso
L. 171 - H. 182 - P. 24
Tangram sole
L. 108 - H. 199 - P. 24
Prezzo a partire da (materasso
escluso)/ Price from (mattress
excluded)
€ 6.918
Letto JUSTMAT. Libreria 36e8
laccato bianco e nero.
30mm con struttura laccato
bianco e nero. Altalena
SOFT-SWING laccato bianco.
JUSTMAT bed. 36e8
bookcase, bianco and nero
lacquering. 30mm with bianco
and nero lacquered structure.
SOFT-SWING, white
lacquering.
Altalena/Soft-Swing
L. 56,1 - P. 28,1 - Sp.6
Letto/Bed 240x160
Libreria/Bookcase 36e8
L. 257,6 - H. 128,8 - P. 40,6
30mm
L. 162,2 - H. 220,8 - P. 38,4
Prezzo a partire da (materasso
escluso)/Price from (mattress
excluded)
€ 6.277
Brochure settembre 35.indd 35 7-08-2009 10:37:03
JUSTMAT
1 materasso + 4 ruote = 1 letto. È questa
l’elementare addizione che sta alla base del progetto
JUSTMAT. Una soluzione semplice e funzionale che
ha come protagonista un materasso che si allunga,
si incurva e diventa, così, una testiera.
Le ruote che sostituiscono i piedini rendono il letto
facilmente trasportabile e dinamico.
1 mattress + 4 wheels = 1 bed. This is the
elementary addition underlying the JUSTMAT
project. A simple and functional solution focusing
on a mattress that can be elongated and shaped
to become a bed-head. The wheels in place of feet
make this bed easy to move and dynamic.
Letto JUSTMAT
JUSTMAT Bed
160x240
Prezzo a partire da (materasso
escluso)/Price from (mattress
excluded)
€ 2.090
Letto JUSTMAT con testiera
col. righe. Armadio N.O.W.
(comp. 122) con ante battenti
e fi anchi in vetro lucido prato,
rosso, verde acido, kaki, lilla,
bosco e in vetro opaco bianco
e nero. Cassettiere MORGANA
con ruote, in vetro lucido
bianco.
JUSTMAT bed with headrest
col. striped. N.O.W. wardrobe
(comp. 122) with conventional
doors and polished glass
sides in the colours prato,
rosso, verde acido, kaki, lilla,
bosco and opaque glass in
the colours bianco and nero.
MORGANA bianco polished
glass chest of drawers with
wheels.
Letto/Bed 160x240
Armadio/Wardrobe
L 369,5 - H 265 - P 60,9
Comodini e cassettiera
MORGANA/Chest of drawers
and Bedside table MORGANA
L 60 - H 48,3/138,3 - P 45,3
1
2
1
2
Tutti i prezzi indicati si intendono escluso progettazione, trasporto e montaggio. All given prices exclude design, transport and assemblage.
Brochure settembre 36.indd 36 7-08-2009 10:29:04
37
STEPSDesign Monica Graffeo
Una sedia e un letto dall’aspetto materico.
Il rigore e la pulizia formale, insieme alla
componente ludica di questi due prodotti,
defi niscono il loro carattere.
Per assemblare sedia e letto è suffi ciente far calzare
sulla rispettiva struttura in alluminio le corrispondenti
fette di feltro che, nel caso del letto, possono essere
anche allontanate rendendolo personalizzabile.
A solid chair and bed with a lightweight appearance.
Formal rigour and purity, together with the
delightful design of these two products, ensure
strong character.
The chair and bed are easy to assemble - simply fi t
the felt pads on the respective aluminium structure.
These “pads”, for the bed, can also be positioned at
a distance for maximum “customisation”.
STEPS_B con struttura in
alluminio e seduta, schienale e
testata in feltro grigio.
STEPS_B with aluminum
structure and grey felt sit, back
and headboard.
Letto/Bed L. 165 - H. 86,7 - P. 224
Prezzo a partire da (materasso
escluso)/Price from (mattress
excluded)
€ 2.150
STEPS_C con struttura in
alluminio e seduta, schienale
e testata in feltro grigio.
STEPS_C with aluminum
structure and grey felt sit,
back and headboard.
L. 45 - H. 77 - P. 51
Prezzo a partire da/Price from
€ 230
1
2 1
2
Brochure settembre 37.indd 37 7-08-2009 10:45:39
FLUTTUAFLUTTUA è un letto sospeso, regolabile in altezza
e disponibile nelle forme rotonda e rettangolare.
FLUTTUA è il letto dal quale abbiamo tolto il
superfl uo lasciando spazio al pensiero.
La caratteristica del prodotto è quella di avere solo
una gamba centrale e di essere composto da un
pianale di spessore 8 mm abbinato a una solida
struttura in ferro da fi ssare alla parete.
FLUTTUA is a suspended, height-adjustable bed
available in round and rectangular models.
The FLUTTUA bed eliminates everything superfl uous
to leave more room for thought.
The characteristic of the product is its single,
height-adjustable central leg and 8 mm thick layer
base combined with a solid iron structure anchored
to the wall.
1
Tutti i prezzi indicati si intendono escluso progettazione, trasporto e montaggio. All given prices exclude design, transport and assemblage.
Brochure settembre 38.indd 38 7-08-2009 10:31:07
39
Letto FLUTTUA R con testiera
in pelle bianca e illuminazione
sottorete. Armadio N.O.W.
con ante battenti e fi anchi
in vetro lucido bianco.
Comò 36e8 laccato bianco
con specchio argentato.
Comodini 36e8 laccato
bianco.
FLUTTUA R bed with white
leather headboard and under
slat lighting. N.O.W. wardrobe
with hinged doors and sides in
white matt glass. 36e8 chest
of drawers, white lacquering
with silver mirror.
36e8 bedside tables, white
lacquering.
Letto/Bed
L. 180 - P. 205 - H. 48/63
Armadio/ Wardrobe
L. 316,5 - H. 265 - P. 60,9
Comò/Chest of drawers
L. 147,2 - H. 55,2 - P. 40,6
Comodini/Bedside tables
L. 73,6 - H. 18,4/36,8 - P. 40,6
Specchio/Mirror
L. 147,2 - H. 73,6 - P. 2
Prezzo a partire da (materasso
escluso)/Price from (mattress
excluded)
€ 9.057
1
Brochure settembre 39.indd 39 7-08-2009 10:18:47
NOT ONLY WHITE
An inifi nitely customisable wardrobe.
A hideaway cabinet-wardrobe that integrates
perfectly with home architecture hidden between
the walls. Innovative colour and a fl exible and
versatile system that meets everyone’s needs.
Not just a simple modular system but a product
that combines the fi nal object with dreams.
The modular bands (21-115 cm with many
intermediate widths) create the design of this
wardrobe-cabinet by defi ning a new visual rhythm;
moreover, the innovative door opening system
eliminates handles to blend N.O.W. with the
architecture of the wall or by creating new colour
moods in harmony with adjacent settings.
The result is a truly made-to-measure solution in
terms of dimensions and also sensations: every
band in short can have a different colour.
L’armadio personalizzabile all’infi nito
L’armadio che scompare e si integra perfettamente
con l’architettura della casa nascondendosi tra
le pareti. Con un uso del colore innovativo e un
sistema così fl essibile e versatile da essere a misura
di desiderio di ciascuno. Non un semplice sistema
componibile, ma un prodotto che fa coincidere il
sogno pensato con l’oggetto realizzato.
Le fasce modulari, da 21 a 115cm con molteplici
larghezze intermedie, creano il design dell’armadio
dando un nuovo ritmo visivo e, inoltre, l’innovativo
sistema di apertura delle ante cancella le maniglie
mimetizzando N.O.W. con l’architettura della parete,
oppure creando nuovi mood cromatici in armonia
con gli ambienti circostanti.
Nasce così una soluzione realmente al centimetro,
per le dimensioni ma anche per le sensazioni: ogni
fascia può assumere infatti un colore differente.
1
Tutti i prezzi indicati si intendono escluso progettazione, trasporto e montaggio. All given prices exclude design, transport and assemblage.
Brochure settembre 40.indd 40 7-08-2009 10:48:13
41
N.O.W.: comp. 101
Ante battenti e fi anchi
in vetro opaco bianco ed in
vetro lucido cocco e panna.
Hinged doors and sides
in bianco coloured matt
glass and cocco and panna
coloured bright glass.
L. 401,5 - H. 265 - P. 60,9
Prezzo a partire da/Price from
€ 5.240
Con la semplice pressione
della mano si crea una
depressione che permette di
aprire l’anta.
A new type of opening: the
door can be opened with a
simple push.
N.O.W.: comp. 105
Ante battenti e fi anchi in vetro
opaco bianco.
Hinged doors and sides in
bianco coloured matt glass.
L. 510,5 - H. 265 - P. 60,9
Prezzo a partire da/Price from
€ 6.690
N.O.W.: comp. 106
Ante battenti e fi anchi in vetro
opaco bianco, sole e prato,
in vetro lucido nero e blu
oltremare. Anta scorrevole
in vetro lucido rosso.
Hinged doors and sides
in bianco, sole and prato
coloured matt glass and nero
and blu oltremare coloured
bright glass. Sliding door in
rosso coloured bright glass.
L. 302,5 - H. 243 - P. 66,7
Prezzo a partire da/Price from
€ 4.150
2
3
4
1
2
3
4
Brochure settembre 41.indd 41 7-08-2009 11:02:46
Un materasso avvolto come la cialda di un cono
gelato infi lato dentro una piccola base cilindrica
in legno. Questa è l’accogliente e pratica poltrona
HUGGY. La presa dell’anello di base stringe la
parte inferiore del materasso tenendolo unito
e creando una avvolgente seduta con morbidi
braccioli. Sfi lando la base, il materasso si srotola
automaticamente e diventa all’occorrenza un
comodo letto d’emergenza per ospiti; la base si
capovolge e diventa un utile comodino.
A mattress wrapped like the wafer of an ice-cream
cone inserted inside a small cylindrical wooden base.
This is the inviting and practical HUGGY armchair.
The hold of the base ring grips the lower part of
the mattress, holding it together and creating a
wrap-around seat with soft arms. By unscrewing
the base, the mattress is automatically unrolled and
when required becomes a comfortable emergency
bed for guests; when the base is turned upside-down
it becomes a useful night table.
Poltroncina HUGGY
HUGGY Armchair
Poltrona/Armchair
130x78x64
Materasso/Mattress
175x85
Base-comodino/Base-nigh table
D. 64 - H. 35 - Sp. 12
Prezzo a partire da/Price from
€ 910
1
1
HUGGYDesign Brit Leissler/Lagostudio
Tutti i prezzi indicati si intendono escluso progettazione, trasporto e montaggio. All given prices exclude design, transport and assemblage.
Brochure settembre 42.indd 42 7-08-2009 11:01:52
43
1
Brochure settembre 43.indd 43 7-08-2009 11:00:57
Carlo Dalcielo EN PLEIN AIRA cura di Bruno Lorini e Giulio Mozzi
Un progetto speciale che, attraverso un intervento semplice e
silenzioso come quello della pittura ad olio, crea una serie di
situazioni e relazioni coinvolgendo non solo il pittore e la sua tela, ma
anche l’ambiente e le persone, facendoli diventare parte integrante
dell’azione. L’azienda è vista come un paesaggio ed il pittore con la
sua tela provoca il nostro sguardo, lo amplifica - o lo filtra - ci invita -
o ci costringe – ad usare i nostri occhi in modi inaspettati.
A special, unique project that sets up diverse atmospheres simply
through silent oil painting. Painting involves not only the painter
with his canvas, but also the surrounding environment and people
who become a whole with the action itself. The company is ideally
conceived as the landscape and the painter with his canvas captures
our looks. He invites us and forces us to watch through different eyes.
ART WAITING ROOM
6 Luglio 2009 - 25 Settembre 2009
Lun/Ven 8.30-12 e 14.30-18 Sab e Dom chiuso.
L’Art Waiting Room è il modo in cui LAGO
ha interpretato la propria sala d’attesa.
Progetto in collaborazione con: Fondazione March
LAGO S.p.A
Via dell’Artigianato ll n.21
35010 Villa del Conte, Padova, Italia
T +39.049.599.4299 F +39.049.599.4191
www.lago.it
Brochure settembre 44.indd 44 7-08-2009 11:01:33