Download - Lago News 2009

Transcript
Page 1: Lago News 2009

1

#5

LAGONEWS APRILE 2009

01BrochureMilano.indd 1 16-04-2009 11:36:17

Page 2: Lago News 2009

LAGO HOMESDesign Frammenti

Una storia, una vita, un modo di usare lo spazio

che ci sta attorno… ognuno di noi vive lo spazio

dell’abitare in modo unico, irripetibile. I prodotti

LAGO contengono la possibilità di dare un’immagine

a questa unicità. Da qui l’idea di LAGO HOMES,

per dare una forma unica alla propria casa,

sperimentando soluzioni che fondano architettura

e design. Ogni casa diventa una storia, i prodotti

diventano i mattoni con cui costruire questa storia,

con cui fare architettura. Il progetto LAGO HOMES

segna l’inizio di una sperimentazione e nel contempo

riassume lo spirito LAGO, gli ingredienti della nostra

passione, del nostro lavoro attorno a ciò da cui non

possiamo prescindere: HOME.

One story, one life, one way to use the space

surrounding us: each of us live his/her living space in

a unique and unrepeatable way. The LAGO

products contain the possibility to offer a picture

of such uniqueness. Hence the idea of LAGO

HOMES, in order to give an outstanding shape to

people’s home, experimenting solutions which melt

architecturte with design. Each home becomes a

story, and the products become the bricks

with which people build their story, with which they

can become architects. The LAGO HOMES project

marks the beginning of a testing process and, at

the same time, summarizes the LAGO spirit, the

ingredients of our passion, of our work on this and

from which we cannot do without: HOME.

1

2

hOMe

Prodotti utilizzati: Air, Now.

Product used: Air, Now.

Having Only More Earth

Prodotti utilizzati: 36e8 cucina,

36e8 e Now.

Product used: 36e8 cucina,

36e8 and Now.

1

2

02BrochureMilano.indd 2 16-04-2009 11:35:34

Page 3: Lago News 2009

3

1

2

03BrochureMilano.indd 3 16-04-2009 11:35:54

Page 4: Lago News 2009

36e8

Basato su un modulo da 36,8 cm x 36,8 cm questo

sistema dona allo spazio forma e sostanza creando

volumi di differente lunghezza da accostare gli

uni agli altri con innumerevoli opportunità di

contenimento.

Con 36e8 tutti possono diventare i designer

del proprio spazio. Come? Accostando i moduli

36e8 per disegnare la composizione che soddisfa

maggiormente gusto e necessità.

Based on a 36.8 cm x 36.8 cm module, this system

gives space a form and substance by creating

volumes of different lengths that can be matched

together in endless combinations.

36e8 means that everyone can design their own

home spaces. How? 36e8 modules can be mixed

and matched to design compositions meeting every

taste and requirement.

1

36e8: comp. 170

Contenitori in vetro lucido lilla,

paglia, bianco e in vetro

opaco nero.

Lilla, paglia, bianco polished

glass and nero opaque glass

storage units.

L 358,8 H 207 P 27/40,6/56

Prezzo a partire da/Price from

€ 4.242

1 36e8: comp. 164

Contenitori in vetro lucido

grafi te, aragosta, mandorla,

salvia, sole, verde acido,

bosco e fumo.

Grafi te, aragosta, mandorla,

salvia, sole, verde acido,

bosco and fumo polished

glass storage units.

L 368 H 202,4 P 27/40,6/56

Prezzo a partire da/Price from

€ 4.140

2

04BrochureMilano.indd 4 16-04-2009 11:36:45

Page 5: Lago News 2009

05BrochureMilano.indd 5 16-04-2009 11:37:24

Page 6: Lago News 2009

36e8: comp. 171 Contenitori in vetro lucido bianco, amaranto e in vetro opaco nero.

Bianco, amaranto polished glass and nero opaque glass storage units.

L 368 H 211,6 P 27/40,6/56 Prezzo a partire da/Price from € 4.945

06BrochureMilano.indd 6 16-04-2009 11:38:03

Page 7: Lago News 2009

7

07BrochureMilano.indd 7 16-04-2009 11:38:35

Page 8: Lago News 2009

36e8: comp. 161

Contenitori in vetro lucido

bianco, lilla, verde acido,

paglia e grafi te.

Bianco, lilla, verde acido,

paglia and grafi te polished

glass storage units.

L. 772,8 - H. 259,3 - P. 27/40,6

Prezzo a partire da/Price from

€ 10.643

36e8: comp. 150

Contenitori in vetro lucido

kaki, verde acido e in vetro

opaco bianco.

Kaki, verde acido polished

glass and bianco opaque glass

storage units.

L 404,8 H 222,5 P 27/40,6/56

Prezzo a partire da/Price from

€ 5.076

36e8: comp. 173

Contenitori in vetro lucido

bianco, paglia, spago e sole.

Bianco, paglia, spago and sole

polished glass storage units.

L 515,2 H 167,3 P 27/56

Prezzo a partire da/Price from

€ 6.286

1

2

3

1

2

3

08BrochureMilano.indd 8 16-04-2009 11:39:23

Page 9: Lago News 2009

9

30MM

Non importa dove importa come

30MM è l’esile spessore dei fi anchi di questo

nuovo sistema di librerie LAGO che grazie ad

uno speciale attacco a muro può essere fi ssato

a parete e anche sospeso. Questa versatilità

consente di creare composizioni fantasiose come

alberi, nuvole, forme astratte, semplici o eleganti.

Il sistema 30MM è disponibile anche con fi anchi e

ripiani di spessore 50mm e 80mm.

30MM - LAGO’s new slim line bookshelf system

that, thanks to a special wall-mounting system,

can be secured to or suspended from walls.

Such versatility can be exploited to create

imaginative compositions such as trees, clouds,

abstract, simple or elegant shapes.

The 30MM system is also available with sides and

tops in 50mm and 80mm thicknesses.

1

2

30MM: comp. 15/16

Laccato castagno e bosco.

Castagno and bosco

lacquering.

L. 281,6 - H. 369,7 - P. 38,4

L. 202 - H. 296,1 - P. 38,4

Prezzo a partire da/Price from

€ 2.163 (comp.15)

€ 3.478 (comp.16)

30MM: comp. 31

Laccato aragosta.

Aragosta lacquering.

L. 401 - H. 184 (H. 202,4 da

terra/from fl oor) - P. 38,4

Prezzo a partire da/Price from

€ 2.889

1

2

09BrochureMilano.indd 9 16-04-2009 11:40:32

Page 10: Lago News 2009

Nasce la cucina non cucina 36e8 cucina è un progetto che alleggerisce la

percezione di ingombro e pienezza delle cucine viste

sino ad oggi; l’approccio progettuale è totalmente

rivoluzionario: nasce la cucina-non-cucina che si

sgancia dai rigidi schemi compositivi e consente di

creare volumi e forme sorprendenti.

Questa innovazione dà voce alla “quarta dimensione

del progetto” che è in grado di evocare alberi,

nuvole, aragoste, etc…

I contenitori, posizionabili orizzontalmente e

verticalmente, possono essere composti in modo

infi nito su un’ipotetica griglia (36,8cm x 36,8cm)

che lascia libertà di composizione, tenendo equilibri

formali eccellenti.

Agli ambienti domestici, spesso sovraccarichi di

oggetti dalle elevate prestazioni tecnologiche, LAGO

crede invece nel bisogno di più amore, armonia

e calore. L’innovazione semiotica della “quarta

dimensione”, pur essendo accattivante, garantisce

risposte eccellenti in termini di praticità e funzionalità

senza dimenticare che la funzione primaria rimane

cucinare.

1

The 36e8 cucina project today takes a lighter

approach to perception, overall dimensions and

solidity for kitchen suites; this design approach is

totally revolutionary: our kitchen-non-kitchen suites

break away from rigid outlines and modularity to

create astonishing volumes and forms.

This innovation expresses the “fourth project

dimension” to evoke trees, clouds, lobsters, etc…

Storage units can be positioned horizontally or

vertically and combined in infi nite ways around a

hypothetical grid (36.8cm x 36,8cm) ensuring both

design freedom and excellent formal composition.

Household settings are often over-loaded with

high-tech devices - yet LAGO on the other hand

believes that more love, harmony and warmth are

essential. The semiotic innovation of the “fourth

dimension” is both very attractive and also ensures

excellent responses in practical and functional

terms without forgetting that the primary function is

“cooking”. The 36e8 kitchen suites system develops

around three macro areas: N.O.W bases, wall units

and cupboards.

Tutti i prezzi indicati si intendono escluso progettazione, trasporto e montaggio. All given prices exclude design, transport and assemblage.

10BrochureMilano.indd 10 16-04-2009 13:50:04

Page 11: Lago News 2009

11

1

36e8 Cucina: comp. 200

Laccato kaki, prato, bianco,

bosco, salvia e castagno

con top “Laminglass” e ante

in vetro lucido.

Lacquered kaki, prato, bianco,

bosco, salvia and castagno

with “Laminglass” top and

door panels in polished glass.

L. 460 - H. 240,4 - P. 40,6/67

Prezzo a partire da/Price from

€ 9.400 (Elettrodomestici e

dispensa esclusi/ Appliances

and storeroom excluded)

Dispensa N.O.W.

Laccato prato, bosco,

salvia e castagno con ante

in vetro lucido.

N.O.W. Storeroom.

Lacquered prato, bosco,

salvia and castagno with

door panels in polished glass.

L. 294,8 - H. 227 - P. 67

1

2

2

1

11BrochureMilano.indd 11 16-04-2009 11:52:09

Page 12: Lago News 2009

1

36e8 Cucina: comp. 209 Laccato aragosta con top “Laminglass” e ante in vetro lucido. Dispensa N.O.W. Laccato kaki, nero e bianco con ante in vetro lucido.

Lacquered aragosta with “Laminglass” top and door panels in polished glass. N.O.W. Storeroom. Lacquered kaki, nero and bianco with door panels in polished glass.

L. 441,6 - H. 202 - P. 40,6/67 Prezzo a partire da/Price from € 6.410 (Elettrodomestici e dispensa esclusi/Appliances and storeroom excluded).

12BrochureMilano.indd 12 17-04-2009 11:01:15

Page 13: Lago News 2009

13

13BrochureMilano.indd 13 17-04-2009 11:02:41

Page 14: Lago News 2009

1

2

14BrochureMilano.indd 14 16-04-2009 11:59:36

Page 15: Lago News 2009

15

Dispensa N.O.W.

Trasferisce in cucina tutti

i plus della zona notte.

Sostituisce la dispensa-

vano elettodomestici con

un vero e proprio armadio

da top di gamma, con

guadagni in termini di

robustezza, risparmio di spazi,

confi gurabilità, semplicità di

forme, qualità delle fi niture e

molteplici opzioni di apertura

dei vani.

Move to the kitchen all the

features from the bedroom.

Plays the role of cupboard

and contains all the

electric devices (apart from

dishwasher), but still keeps

his identity of high quality

wardrobe: is tough as anyone

else, saves more space due to

his special modularity, same

high quality fi nishes of our

successfull wardrobe , clean

design and many different

opening systems.

Touch System

Ovviato il problema delle

impronte di farina su pensili

e cassettoni da aprire

eseguendo acrobazie circensi.

È suffi ciente utilizzare testa,

gambe, gomiti, ginocchia

et voilà!

The Touch System helps you

in bad moments.

How to open a wall-cabinet

after kneading pizza? just a

masterstroke!

How to pick up the knife from

the drawer while cleaning

the fi sh? You only need a

knee (pay attention to your

kneecap, by the way).

Tecnologia nascosta

Andando un po’

controcorrente, abbiamo

deciso di privilegiare armonia,

calore e forme piuttosto

che proporre un ambiente

sovraccarico di tecnologie.

La soluzione?

Le abbiamo nascoste.

Lavastoviglie, cappa, forno,

frigorifero, congelatore sono

ospitati e protetti all’interno

dei moduli.

Clean design hides

technology. The whole project

aim to lighten the perception

of the ordinary kitchen.

Usually cumbersome and full

of things. We prefer balance,

colour, warmth, clean shapes.

That’s why used all of these

solution to keep technology

in hiding. Fan and dishwasher

are hidden into 36e8 cabinets.

Oven, fridge and freezer are

embraced by the N.O.W.

cupboard instead.

1

2

3

3

15BrochureMilano.indd 15 16-04-2009 12:01:50

Page 16: Lago News 2009

36e8 Cucina: comp. 204

Laccato sole e blu oltremare

con top “Laminglass” e ante in

vetro lucido, frigo free-standing.

Lacquered sole and blu oltremare

with “Laminglass” top and

door panels in polished glass,

free-standing refrigerator.

L. 441,6 - H. 195 - P. 40,6/67

Prezzo a partire da/Price from

€ 6.496 (Elettrodomestici

esclusi/Appliances excluded).

36e8 Cucina: comp. 217

Laccato bianco con top

“Laminglass” e ante in

vetro lucido e dispensa.

Lacquered bianco with

“Laminglass” top and

door panels in polished

glass and storeroom.

L. 386,4 - H. 202,4 - P. 40,6/67

Prezzo a partire da/Price from

€ 6.323 (Elettrodomestici

esclusi/Appliances excluded).

36e8 Cucina: comp. 215

Laccato rosso con top e ante

in vetro lucido, dispensa.

Lacquered rosso with top and

door panels in polished glass,

storeroom.

L. 220,8 - H. 93,2 - P. 137

(Isola/Island)

Prezzo a partire da/Price from

€ 14.777 (Elettrodomestici

esclusi/Appliances excluded).

1

2

3

2

3

1

16BrochureMilano.indd 16 16-04-2009 12:02:43

Page 17: Lago News 2009

17

PPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPooooooiiiiiiiiinnnnnnnnntttttttt SSSSSSSSSSSpppppppppppppaaaaaaaaaccccccccceeeeeeeeeeee SSSSSSSSSttttttttooooooooorrrrrrrrrrrre

PPPPPPoPoPoPoPoPoPPPoPPPPPPP ininininnint,t,t,t,t,t P P P PPPoioioioioioo ntntntntnntntnn XXX X XXL,L,L,L,L, SSS SSSSpapapapapaapacececececece, , , ,,, SpSpSpSpSpSSpSpSpacacaacacaacaace e ee ee ee XXXXXLXXXXXX , StStStStStStStStStSSttStSSS ororororrororoorrrrrororrre…e…e…e…e…e…e…e…ee…e…ee…e…e…eee…eeeeee…eee

qqqqqqquququqquqquqququuququesesesese titititit s ss ssononononononno o oo oooo o oooo i ii ii i nonononononostststststss ririririri p p p ppppparaaararrartntntntntnntnt erererererererer. . QuQuQuQuQuQuQ eestiiiiiiiiii

ssssssosososososososssssss nononononooo ii i i n nnnegegeggggeggggggggozozozozozozozozozozozozozozozoozzozozozozozzozozozzziiiiii iiiiiiiiiiiii chchchchhchhchhhhhchhhhchhhhheeeeeeeeee ee eeeee hahhahahahhhhhhhh nnnnnnnnnnnno o o oo o ininninninsisisiiemeemmmmmmmme a aaaaaaaaa a aa a nonononononononononononnnoiiiiiiiii

aaabbabababababbbbrbrbrbrbracacaacciciccic atatatttttttatttoooooooooooooooooooooooooooooo uuununuununununununuuunuuuunuuuuuuuuuunuuu pppppppppppppppppppppppppppppprororororoorooorororororororororororororororooroororrrr gggggegegeggegegg ttttttttttttttt oooooo dididididi rrininnnnnnoonnovaaaaaaaamememememmmmmememeentntntntntnttntn oooooooababaabbbrbrracacaccicc atatatoooo ununn p p p prororogegegetttttttoo didi rrrininiini nonnnovavamemenntnto oo

prprprprpprp opopopoppopo onononononenenenee dododoododoo u u uuun n nn n nununununun ovovovovoovo o o concncccn eteteeetetee totototooo d ddddi ii cacacassasaasaa

LALALAALAALALAGOGOGOGOGOO.. . NoNoNooooon n n nn sososososos lolololololo dd d deeieie fforo mamaaat tt esesessespopoppppp sisissisititit vivivv

dododoodd veveveevvv p p ppppppototottttototerererrerrrrr t t ttt tttrorororooroooroororoovavavavarererer l le e nonoststttrereere proopopoopp ststttttttststttttttte e eee mamammamama

unununna a a rererererereeteteteeteteee d dd dddddddi iiiii pepepepepepepepepepeepersrsr ononoo e eee chchche e e poppp rtrtanano o i i nononooststtstriririiri

vavavavavaavavav lolololoooloooririrrir aa a aaaalllllllllllllll’ii’i’i’’’intntntnttntntnttnttntterererererrrererererererrrnnnnonononnnonnnn d dele le vvvosososo trtre e caseee, cocoonnnn

prpppprprprprprpprpppprpppppp ofofofofofofofffo esesesessesessessssisisisisisiiiis onononnonononononono alalalalalalalalalalla itititittititititiitàààà à ààààà e e cocompppetetettenenzaz . .

DDDaDaDaDaDaDaDDDDaDaDDD l l l l llll lororororororoooro o o o o o o o oo o popopopopopopopopopopopopoooopoop trtrtrtrtrtrtrtrtrtrtrrtrrttrttrt aiaiaiaiaiaaiaiaiaiaiaiaai tttrororrorr vavare nnnuuouoveve i ii dededee eee e eee spspss ununnntitititi

prprprprprprppprpprrogogogogogogogogoggogggggoggoggogooggetetetetetetetteteteteteteteteetetetetetetettettttte tututttutututututtutttutttuualalalaalallalaallaaaaaaaaaaaaaaaa i i ii iiiiii crcrcrcrcrcrcrcrrrcrrrrreeeeaeaeeeaeaeeeeeeaae teteteteteetetee a a aaaaa aaaappp osostata ppperr te eeeee e eeeeeeeeeeeee eeeeeeeee pepppppppppppppppppppppp r rr rr lalalaaa

tututututututuuua aa a aaaa aaaaaaaaaa cacacacacacacacacaaacacacaacaacacaacaacasasasassasssssasasssasasasasasa....

PePePePePePePeerr rrrrrr viviviviviviviviv sususususususuuaalalallaalallizizzazarrere iiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiii nnnnnnnn n n nnn n nnnnnnnnn nnnnnnnnnnnn n nnnn nnnnnneeeeeeeegeeeeeeeeeeeeeeeeeeeeeeeeeee ozi pipipppp ù ùùùùùùùù ùùùùùùùùùùùùùùùùùùù vivivivivivvivivivivivivivvvivivivvvvivvvviivvvvvvvvvv cciciciccccciiciciccicciciccccciccccciciccicccicicccccccccc niniiiniiinnininininininnnn aa v vvvvvvvoioioio

clclclclclclcclclclclclccliciccciccicicciccicicicciccacacacacacacacacaacaccacaccaacaatttetetetetetetetttetete s ss ssssssssu u u wwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwww wwww.wwwwwwwwwwwwwwwwwwwwwwwww LaLLaLaLLLLLLaLLLLLLaLLLLLLLLLLLLLLLLaLLLLLL gogooo i.it ttt - - nenegog ziii

PoPoPooooooPooPoPooooinint,t,,, P PPoioioioioioiointntntntntntntnntntnn X XXXXXXXX XXXXXXXXXXXXXL, Spaceceeceeeeececeeeeecc , , , SpSSSSSSSSSSS ace XLL, StS oro e.

ThThThThhhhThThhThhhheseseseeesse eee ee ararararaarrre eeeee eee ouououuouououoouoouuuouurrrrr rrrrrrrrrrrr papapaapartrtrtrtrtrrtnenen rssrss. ThThTT esese e arararare ee thththt ee

shshshhshshshsshshshshshsshopopopopopopopopopopopopppss ssss sss whwhwhwhwhwho havevev e eeeeeeemmbmmmmmmm raceed, ttogogetetheher

wiiwiwiwiw thththththh u uuuu uuuuuuuuus,s,s,s,s,s,s,s,s,,,,,, a renovovvaatataatataaaaaaatiiiioiiiiii n projjecceccccccccct,t,tt,t,t,t,t, bbbbbb bby yy y yyyyyyyyy

prprprprprppppprpp oopppppppooooooo osososososososososososososososoossssinininininininininininnnnng g g g g g g g g ggg g ggggggg a aaaaaaaa aa aaaa aaa nenennnnnnnnnnnnnnn w w ccccocccoccocc ncncncncncncncncepepepepepepepe t t ofoofofoffoffffofffffffofofof tt ttttttttttttttttttt hehehehehehehehehhehhehhehhehehehhehehhehehe LL Lagago

hohohohohohohohohohohohohoohoooomememememememememememmeemmemmemmmm ........ . NoNoNoNNNNNNNNoNNNNNNNNott t t ononononononnonononnononononnonly exhhibibititittttioioooioioon formmats ss whhere e e

itititittititittitiititittit i i i is poooooooooooooossssssssssssssssssss ibibibibibibibibibiibibibbbbbi leleleleeeeeleeleeleleleleleleeleee t t tttttttto findd ooooouurrruruuruu p roposals, bubut t

aaaaalaaaaaaaa so a neeeteeeeee workrkkk o o oooooooooff fff fffff peppppppp opoopopopoo llelellllele who bringnnn

ououuuuuuuuuuur r rrrrr vavvavvvvvvv luuuuuuueeeeseseeee insiddddddddde e e ee eeee yyyyoyyyyyy ur homommomo eseseseses, , ,, ,, wiwiwiwwiwiwiiththththtthh

prpprprprprprprprppprprprrprpp ofofoffooooofofesesessssssseseeesssisisisisississiiiiooonooooooonoo ala ism mm mm mmm anananananananananannnnnnnnnd d expeeertrtrtrtrtrtrtrtrtttrtrtttisisisisisisissisisisisssisi e.e.e.eee T T T TT TTThehehehehehhhererererere y youou

wwwwwwiwiwiwiwwwww lllllllll bb bbbbbbbe ee eeeeee ababababaabababababababaababa lelelelelleleleeeele tt t ttttoooo o oo fififif ndndndndndndndndndnddnddnd nnewew iiddddededeedeeeededeeedeaasasasasasasasaasasaasaaasasasass aaaaaandndndndndndnd c c ccluluuluueses

ononono hh howowowowowowowowowwowooowww t tooo o o ooooooo plplplplplaanaaanaa a a c cusussustotototototom-m-m-m-m-m-mm mamamamamamamamamamamamamamamaamamamammmmadededededddeddddededdedededddedddedd h hh hhhhomomomomomome e e fof r

yoyoyou.u. T To o seseseseseses e e ee ee e thththththhht e e clclososesesesest tttt ssshsshs opops s clclicick k k onoon

wwwwwwwww.w.wwww.ww.w.www LaLaLaLaLaLLLaLLL ggogogo.i.iit t tt - - shshshshshshshshsshhopopopopopopopooppsssssssss

17BrochureMilano.indd 17 16-04-2009 12:03:31

Page 18: Lago News 2009

AIR

Letto AIR

Testiera in pelle bianca.

Pianale in HPL sorretto da

un telaio metallico fi ssato

su 4 lastre di vetro Starphire

extrachiaro rettangolari.

AIR Bed

Leather headboard.

HPL platform supported

by a metal frame attached

to 4 extra clear rectangular

Starphire glass plates.

180x200 - H. 29-71 o/or 39-81

Prezzo a partire da (materasso

escluso)/Price from (mattress

excluded)

€ 2.340

Letto AIR

Testiera in ecopelle bianco.

Armadio N.O.W. con ante

battenti e fi anchi in vetro

lucido avio, paglia, lilla, bianco

e salvia e in vetro opaco

bianco e paglia. Libreria AIR

laccato paglia, avio, salvia,

bianco e lilla.

AIR bed

White eco-leather headboard.

N.O.W. wardrobe with hinged

doors and sides in avio,

paglia, lilla, bianco and salvia

coloured bright glass and

bianco and paglia coloured

matt glass. AIR bookcase,

paglia, avio, salvia, bianco

and lilla lacquering.

Letto/Bed 120x200

Armadio/Wardrobe N.O.W.

L. 201,5 - H. 265 - P. 60,9

Libreria/Bookcase AIR

L. 310,4 H. 154 P. 40,6

1

2

1

2

18BrochureMilano.indd 18 16-04-2009 12:04:00

Page 19: Lago News 2009

19

Leggerezza estrema

Un nuovo trio di prodotti, libreria, tavolo e letto che

inverte l’ordine dei fattori: leggerezza estrema nelle

strutture portanti, in cristallo trasparente e fi sicità

piena del piano e delle mensole. Il risultato è che

mensole, piano del tavolo e letto fl uttuino nell’aria,

quasi fossero sospese nel vuoto.

All’intero ambiente si conferisce una lettura nuova

dello spazio modifi cando la percezione dei rapporti

pieno/vuoto, leggero/pesante.

Il tavolo è costituito da due lastre perpendicolari

su cui poggia il piano in legno. La libreria è realizzata

con montanti eterei in cristallo che sostengono

le mensole in legno. Posizionata a centro stanza

o addossata al muro la libreria è free-standing ed

evita l’ancoraggio a parete. L’effetto di sospensione

diventa ancor più evidente nel neonato letto AIR.

La base del letto in HPL si appoggia su un telaio

metallico su cui sono innestate 4 lastre di cristallo

che, se ruotate, cambiano l’altezza del letto.

Le venti fi gure del kamasutra che si trovano sotto

il materasso, oltre a divertire e rendere sexy il letto,

consentono al materasso stesso di essere areato.

A new product “trio” - a bookshelf, table and bed

reversing the order of factors: extremely light

load-bearing structures, in transparent crystal glass,

and very solid tops and shelves.

The result is that the shelves, table top and bed

seemingly fl oat on air, almost as if suspended in

a vacuum. The entire setting benefi ts from a new

interpretation of space by modifying perception

of solid/void and light/heavy ratios.

The table comprises two perpendicular plates

supporting the wood top. The bookshelves have

ethereal crystal glass uprights supporting the

wooden shelves. Whether positioned in the middle

of a room or set against a wall, these bookshelves

are free-standing and avoid the need for wall

anchorage. The suspension effect is even more

evident with the brand-new AIR bed. The base

of the bed in HPL is supported by a metal frame

in turn housing 4 crystal glass plates that can be

rotated to modify the height of the bed.

The twenty kamasutra fi gures underneath the

mattress not only make the bed delightful and

sensual but also mean that the mattress itself is

well-aired.

Letto AIR

Testiera in pelle nero.

Armadio N.O.W. con ante

scorrevoli e fi anchi in vetro

lucido salvia, nero, avio,

fumo, lilla, grafi te. Cassettiere

MORGANA laccato avio e lilla

con frontali in vetro.

Comò 36e8 laccato nero.

AIR bed

Black leather headboard.

N.O.W. wardrobe with sliding

doors and sides in salvia,

nero, avio, fumo, lilla, grafi te

bright glass. MORGANA

chest of drawers, avio and lilla

lacquering with glass fronts.

Black lacquered 36e8 chest

of drawers.

Letto/Bed 180x200

Armadio/Wardrobe N.O.W.

L. 287,3 - H. 265 - P. 66,7

MORGANA

L. 60 - H. 54 - P. 45,3

Comò/Chest of drawers

L. 147,2 - H. 552 - P. 40,6

3

3

19BrochureMilano.indd 19 16-04-2009 12:04:59

Page 20: Lago News 2009

Television

È un libro nato come alternativa al finto

televisore usato abitualmente nei negozi

di arredamento, per portare vita, ironia

e fantasia all’interno dei punti vendita

LAGO. Un viaggio di semplici fotogrammi

che ci hanno permesso di raccontare

la storia di ciascuna delle persone che

lavora nella “non fabbrica” e i luoghi che

fanno da cornice a questa realtà.

A book intended as a valid alternative

to the “dummy television” customarily

used in furnishing shops - to ensure a

touch of life, irony and imagination in

LAGO sales points. A travel focusing on

straightforward photographs that helped

us tell the story of

everyone working

in the “non-

factory” and the

places where this

reality is set.

20BrochureMilano.indd 20 16-04-2009 12:06:06

Page 21: Lago News 2009

21

AIR: comp. 72

Laccato verde acido, sole e

bosco. Set vetri porta dvd.

Verde acido, sole and bosco.

Lacquering. Glass set,

dvd player holder.

L. 384 - H. 169,7 - P. 40,6

Prezzo a partire da/Price from

€ 4.471

AIR: comp. 78

Laccato bianco.

Bianco lacquering.

L. 261,4 - H. 423,7 - P. 261,4

Tavolo AIR

Rovere grigio HP.

AIR Table

HP Grey oak.

L. 250 - P. 100 - H. 76

Prezzo a partire da/Price from

€ 1.953

1

2

3

1

2

3

21BrochureMilano.indd 21 16-04-2009 12:06:44

Page 22: Lago News 2009

Una “rete” di cubi

Un cubo, due cubi, una “rete” di cubi da 40

centimetri per lato si incontrano e si combinano

offrendo ad ognuno l’opportunità di creare una

libreria a propria immagine e somiglianza.

NET allarga i confi ni della creatività, e non teme

i limiti spaziali adattandosi con facilità alle situazioni,

dividendo aree e creandone di nuove.

Uno dei suoi punti di forza è il perno di congiunzione

verticale tra un cubo e l’altro: questo consente

la rotazione di ogni singolo elemento.

E così, una composizione lineare e ordinata

può diventare sinuosa e dinamica.

A single cube, two cubes, a “network” of cubes

measuring 40 centimetres per side mix and match

to offer everyone the chance to create bookshelves

with a truly personal touch.

NET expands the boundaries of creativity by

overcoming spatial limitations and easily adapting

to different situations to share existing and create

new spaces. One of its selling points is the vertical

pin between each of the cubes: this means that

every single element can be rotated.

Which in turn means that linear and orderly

composition can become sinuous and dynamic.

NET

1

NET: comp. 52

Laccato bianco.

Bianco lacquering.

L. 527 - H. 281 - P. 299

1 cubo laccato bianco prezzo

a partire da/1 single cube,

bianco lacquering price from

€ 290

1

22BrochureMilano.indd 22 16-04-2009 12:09:35

Page 23: Lago News 2009

APPARTAMENTOTEMPORARY SHOPVIA TORTONA 21 MILANO

1° PIANO

DAL 22 AL 27 APRILE 10.30–24

Re-inventare i luoghi

Galvanizzati dall’innovazione portata nei nostri

prodotti, abbiamo cominciato ad interrogarci

su come cambiare il modo di farli conoscere

alle persone. E non stiamo parlando di pubblicità.

Vogliamo capire se in futuro sarà soltanto il negozio

così come lo conosciamo oggi a farci avvicinare,

conoscere e toccare i mobili oppure potranno

esistere nuovi scenari e nuove opportunità.

Re-inventare i luoghi.

L’appartamento è un progetto all’interno di

questa rifl essione alla quale ci stiamo sempre più

appassionando. E allora noi di LAGO non staremo

in un qualsiasi hotel di Milano in quei giorni di

lavoro allo stand della fi era. Abbiamo disdetto la

prenotazione e ci siamo presi una casa che sarà

arredata completamente con i mobili LAGO.

Vivremo in 13, condividendo la cucina, la doccia,

gli armadi. Al mattino ci sarà chi andrà in fi era e

chi resterà per tenere aperta la casa ai visitatori dei

fuorisalone durante il giorno. Alla sera ci ritroveremo

tutti, assieme a quanti vorranno cenare con noi, o

passare per un brindisi. Basta suonare il campanello

e vi apriremo.

L’appartamento è un progetto naturale.

Che riparte da zero, dalle persone e dalle relazioni,

dalle sensazioni e dalle opinioni che possono

nascere toccando non solo un prodotto ma anche

un progetto, rimettendo in discussione tutto quello

che ci hanno detto bisogna fare per forza durante la

design week milanese.

Galvanised by the innovative capacity of our

products, we have begun to ask ourselves how

we can change the way they are communicated to

people. And we are not talking about advertising.

We want to understand whether, in the future,

shops as we know them today will still be the only

way we can get in touch with people and ensure

hands-on experience of our furniture or if there are

new scenarios and new opportunities.

Re-inventing places.

The Apartment is an exciting project continually

focusing our passion on this consideration.

Inasmuch, LAGO will not merely stay in a hotel in

Milan over these days of work on the stand at the

exhibition. We have cancelled our booking and have

rented a 300 sq.m. fl at on the fi rst fl oor of

Via Tortona that will be completely set up with

Lago furniture.

Thirteen of us will live there, sharing the kitchen,

shower and wardrobes. In the morning, some of

us will go to the exhibition and other will “stay at

home” to welcome “off-show” visitors during the

day. In the evening, we will all get together with

anyone who would like to have dinner with us or

drop by for a drink. Simply ring the bell for a warm

welcome.

The Apartment is a natural project. An approach

starting from scratch, from people and relationships,

from sensations and opinions, stimulated not only

by hands-on experience of products but also and

especially by a project ensuring in-depth discussion

of everything suggested to us during the

Milan design week.

appartamento.lago.it

23BrochureMilano.indd 23 16-04-2009 12:10:02

Page 24: Lago News 2009

24BrochureMilano.indd 24 17-04-2009 8:22:08

Page 25: Lago News 2009

25

25BrochureMilano.indd 25 17-04-2009 8:22:22

Page 26: Lago News 2009

26BrochureMilano.indd 26 16-04-2009 12:13:10

Page 27: Lago News 2009

27

Non sai cosa cucinare oggi?

segui le ricette di Mimmo su:

appartamento.Lago.it

You don’t know what to cook

today? Follow Mimmo’s recepit on:

appartamento.Lago.it

27BrochureMilano.indd 27 16-04-2009 12:14:09

Page 28: Lago News 2009

Nuovo 30mm

New 30mm

28BrochureMilano.indd 28 16-04-2009 12:19:12

Page 29: Lago News 2009

29

29BrochureMilano.indd 29 16-04-2009 12:20:06

Page 30: Lago News 2009

Studio dell’Appartamento

Appartamento studio

30BrochureMilano.indd 30 16-04-2009 12:20:28

Page 31: Lago News 2009

31

31BrochureMilano.indd 31 16-04-2009 12:21:27

Page 32: Lago News 2009

Il nuovo 36e8 bagno

The new 36e8 bagno

The online design magazine Core77 will have their temporary

offi ce based in the apartment and create the post

production of their Milan Design Week coverage from here.

Additionally to their usual extensive coverage of all the hot

stuff happening on the fair and the interni shows, Core77 will

this year also invite people to interview in their offi ce and

report daily from the Appartamento project.

With the interviews Core77 is seeking to create a

“post futurist manifesto” - in dialogue with some of the

current ‘movers and shakers’ of the design world.

La rivista di design online Core77 usufruirà provvisoriamente

dell’Appartamento come uffi cio, e da qui si occuperà del

reportage del post-produzione della Design Week di Milano.

Oltre ad un ampio reportage di tutti gli eventi più salienti della

fi era ed agli show esterni, quest’anno Core77 inviterà anche

delle persone per intervistarle nel loro uffi cio e creare un

report giornaliero del progetto dell’Appartamento. Attraverso

queste interviste, Core 77 cerca di creare un ‘manifesto

post-futurista’ - dialogando con alcuni dei personaggi che

attualmente ‘muovono e scuotono’ il mondo del design.

32BrochureMilano.indd 32 16-04-2009 12:22:13

Page 33: Lago News 2009

33

STEPSDesign Monica Graffeo

Una sedia e un letto dall’aspetto materico.

Il rigore e la pulizia formale, insieme alla

componente ludica di questi due prodotti,

defi niscono il loro carattere.

Per assemblare sedia e letto è suffi ciente far calzare

sulla rispettiva struttura in alluminio le corrispondenti

fette di feltro che, nel caso del letto, possono essere

anche allontanate rendendolo personalizzabile.

A solid chair and bed with a lightweight appearance.

Formal rigour and purity, together with the

delightful design of these two products, ensure

strong character.

The chair and bed are easy to assemble - simply fi t

the felt pads on the respective aluminium structure.

These “pads”, for the bed, can also be positioned at

a distance for maximum “customisation”.

STEPS_B con struttura in

alluminio e seduta, schienale e

testata in feltro grigio.

STEPS_B with aluminum

structure and grey felt sit, back

and headboard.

Letto/Bed L. 165 - H. 86,7 - P. 224

Prezzo a partire da (materasso

escluso)/Price from (mattress

excluded)

€ 2.150

STEPS_C con struttura in

alluminio e seduta, schienale

e testata in feltro grigio.

STEPS_C with aluminum

structure and grey felt sit,

back and headboard.

L. 45 - H. 77 - P. 51

Prezzo a partire da/Price from

€ 230

1

2 1

2

33BrochureMilano.indd 33 16-04-2009 12:22:49

Page 34: Lago News 2009

JUSTMAT

1 materasso + 4 ruote = 1 letto. È questa

l’elementare addizione che sta alla base del progetto

JUSTMAT. Una soluzione semplice e funzionale che

ha come protagonista un materasso che si allunga,

si incurva e diventa, così, una testiera.

Le ruote che sostituiscono i piedini rendono il letto

facilmente trasportabile e dinamico.

1 mattress + 4 wheels = 1 bed. This is the

elementary addition underlying the JUSTMAT

project. A simple and functional solution focusing

on a mattress that can be elongated and shaped

to become a bed-head. The wheels in place of feet

make this bed easy to move and dynamic.

Letto JUSTMAT

JUSTMAT Bed

160x240

Prezzo a partire da (materasso

escluso)/Price from (mattress

excluded)

€ 2.090

Letto JUSTMAT con testiera

col. righe. Armadio N.O.W.

(comp. 122) con ante battenti

e fi anchi in vetro lucido prato,

rosso, verde acido, kaki, lilla,

bosco e in vetro opaco bianco

e nero. Cassettiere MORGANA

con ruote, in vetro lucido

bianco.

JUSTMAT bed with headrest

col. striped. N.O.W. wardrobe

(comp. 122) with conventional

doors and polished glass

sides in the colours prato,

rosso, verde acido, kaki, lilla,

bosco and opaque glass in

the colours bianco and nero.

MORGANA bianco polished

glass chest of drawers with

wheels.

Letto/Bed 160x240

Armadio/Wardrobe

L 369,5 - H 265 - P 60,9

Comodini e cassettiera

MORGANA/Chest of drawers

and Bedside table MORGANA

L 60 - H 48,3/138,3 - P 45,3

1

2

1

2

34BrochureMilano.indd 34 16-04-2009 12:27:42

Page 35: Lago News 2009

35

BEAMDesign Ewan Robertson/Lagostudio

Il letto Beam si ispira ad una fi gura di elementare magnifi cenza: il sole

La base del letto è costituita da un sistema di assi

che, partendo da un fulcro centrale, si aprono a

raggiera verso l’esterno. Il sistema di illuminazione

della base del letto, che irradia fasci di luce

chiaro-scuro, crea nella camera da letto un’atmosfera

delicata e scenografi ca. Con BEAM viene, ancora una

volta, stravolta l’idea del letto che si regge su quattro

gambe: il tentativo è dimostrare che la creatività,

spesso, la si può ricondurre alla capacità di cambiare

punto di vista. In questo modo il sole va a letto.

BEAM Bed is inspired by an elementary yet

magnifi cent fi gure: the sun. The base of the bed

comprises a system of “beams” that extend

outwards from a central fulcrum. The lighting system

at the base of the bed creates “chiaroscuro” effects

in the bedroom ensuring a delicate and scenographic

atmosphere. BEAM - once again - overturns the idea

that beds must have four legs: the concept hopefully

demonstrates that creativity can often be traced to

a capacity for changing points of view. In this way,

even the sun goes to bed.

3

4

Struttura letto BEAM.

BEAM bed structure.

Prezzo a partire da/Price from

€ 1.450

Letto BEAM laccato grafi te

con testiera in pelle col. 454.

Comodini 36e8 in vetro opaco

spago.

BEAM grafi te lacquered bed

with leather headrest col. 454.

36e8 spago opaque glass

bedside tables.

Letto/Bed 160x210

Comodini/Bedside tables

L 73,6 - H 18,4 - P 40,6

3

4

35BrochureMilano.indd 35 16-04-2009 12:28:26

Page 36: Lago News 2009

FLUTTUAFLUTTUA è un letto sospeso, regolabile in altezza

e disponibile nelle forme rotonda e rettangolare.

FLUTTUA è il letto dal quale abbiamo tolto il

superfl uo lasciando spazio al pensiero.

La caratteristica del prodotto è quella di avere solo

una gamba centrale e di essere composto da un

pianale di spessore 8 mm abbinato a una solida

struttura in ferro da fi ssare alla parete.

FLUTTUA is a suspended, height-adjustable bed

available in round and rectangular models.

The FLUTTUA bed eliminates everything superfl uous

to leave more room for thought.

The characteristic of the product is its single,

height-adjustable central leg and 8 mm thick layer

base combined with a solid iron structure anchored

to the wall.

1

36BrochureMilano.indd 36 16-04-2009 12:29:18

Page 37: Lago News 2009

37

Letto FLUTTUA R con testiera

in pelle bianca e illuminazione

sottorete. Armadio N.O.W.

con ante battenti e fi anchi

in vetro lucido bianco.

Comò 36e8 laccato bianco

con specchio argentato.

Comodini 36e8 laccato

bianco.

FLUTTUA R bed with white

leather headboard and under

slat lighting. N.O.W. wardrobe

with hinged doors and sides in

white matt glass. 36e8 chest

of drawers, white lacquering

with silver mirror.

36e8 bedside tables, white

lacquering.

Letto/Bed

L. 180 - P. 205 - H. 48/63

Armadio/ Wardrobe

L. 316,5 - H. 265 - P. 60,9

Comò/Chest of drawers

L. 147,2 - H. 55,2 - P. 40,6

Comodini/Bedside tables

L. 73,6 - H. 18,4/36,8 - P. 40,6

Specchio/Mirror

L. 147,2 - H. 73,6 - P. 2

Prezzo a partire da (materasso

escluso)/Price from (mattress

excluded)

€ 9.057

1

37BrochureMilano.indd 37 16-04-2009 12:30:37

Page 38: Lago News 2009

Kids

Gli stessi “ingredienti” che hanno caratterizzato

gli altri ambienti della casa, ovvero i consolidati

prodotti LAGO, si amalgamano creando

ambientazioni più fresche, più vivaci e vicine a quella

fase della vita in cui tutto è gioco. La giovinezza.

Una fase in cui è ancora lecito “volare” con la

fantasia: è così che l’armadio di un bambino diventa

un grande pesce rosso. È così che un serpente

si insinua nella stanza. È così che una fi ammante

Ferrari si materializza sulla parete.

Un design a misura di bambino e non a misura

d’uomo: ecco la nuova ricetta.

The same “ingredients” characterising LAGO’s

renowned products for other home settings now

blend to create even fresher and livelier atmospheres

for the time of life when everything is playtime. Kids!

An age where “fl ights of fantasy” are so important:

which is why our wardrobe for kids resembles a

huge goldfi sh. Or a snake swirling into the bedroom.

Or a bright red Ferrari materialising on the wall.

Design for kids - not for adults: this is the new

approach.

1

2

38BrochureMilano.indd 38 16-04-2009 13:31:32

Page 39: Lago News 2009

39

Letto AIR

Testiera in pelle bianco.

Libreria 36e8 laccato aragosta,

bianco e nero.

AIR Bed

White leather headboard.

36e8 bookcase, aragosta,

bianco and nero lacquering.

Letto/Bed 180x200

Libreria/Bookcase 36e8

L. 368 - H. 190,4 - P. 40,6/56

Prezzo a partire da (materasso

escluso)/Price from (mattress

excluded)

€ 8.912

Letto JUSTMAT. Libreria 36e8

laccato bianco e nero.

30mm con struttura laccato

bianco e nero. Altalena

SOFT-SWING laccato bianco.

JUSTMAT bed. 36e8

bookcase, bianco and nero

lacquering. 30mm with bianco

and nero lacquered structure.

SOFT-SWING, white

lacquering.

Altalena/Soft-Swing

L. 56,1 - P. 28,1 - Sp.6

Letto/Bed 240x160

Libreria/Bookcase 36e8

L. 257,6 - H. 128,8 - P. 40,6

30mm

L. 162,2 - H. 220,8 - P. 38,4

Prezzo a partire da (materasso

escluso)/Price from (mattress

excluded)

€ 6.277

Libreria 36e8 laccato verde

acido e bosco. Comodino 36e8

laccato bosco. STEPS_B con

struttura in alluminio e seduta,

schienale e testata in feltro

nero. Mensole PONTACCIO

laccato bosco.

Altalene SOFT-SWING laccato

bosco e prato.

36e8 bookcase, verde acido

and bosco lacquering.

36e8 bedside table, bosco

lacquering. STEPS_B with

aluminium structure and grey

felt sit, back and headboard.

PONTACCIO shelves bosco

lacquered. SOFT-SWING,

bosco and prato lacquering.

Libreria/Bookcase 36e8

L. 612,4 - H. 147,2 - P. 151,3

Comodino/Bedside table

L. 36,8 - H. 18,4 - P. 40,6

Letto/Bed

L. 130 - H. 86 - P. 165

PONTACCIO

L. min 100/max 162 - H. 38 -

P. 18/24

SOFT-SWING

L. 56,1 - P. 28,1 - Sp.6

Prezzo a partire da (materasso

escluso)/Price from (mattress

excluded)

€ 5.070

3

1

2

3

39BrochureMilano.indd 39 16-04-2009 13:32:49

Page 40: Lago News 2009

NOT ONLY WHITE

An inifi nitely customisable wardrobe.

A hideaway cabinet-wardrobe that integrates

perfectly with home architecture hidden between

the walls. Innovative colour and a fl exible and

versatile system that meets everyone’s needs.

Not just a simple modular system but a product

that combines the fi nal object with dreams.

The modular bands (21-115 cm with many

intermediate widths) create the design of this

wardrobe-cabinet by defi ning a new visual rhythm;

moreover, the innovative door opening system

eliminates handles to blend N.O.W. with the

architecture of the wall or by creating new colour

moods in harmony with adjacent settings.

The result is a truly made-to-measure solution in

terms of dimensions and also sensations: every

band in short can have a different colour.

L’armadio personalizzabile all’infi nito

L’armadio che scompare e si integra perfettamente

con l’architettura della casa nascondendosi tra

le pareti. Con un uso del colore innovativo e un

sistema così fl essibile e versatile da essere a misura

di desiderio di ciascuno. Non un semplice sistema

componibile, ma un prodotto che fa coincidere il

sogno pensato con l’oggetto realizzato.

Le fasce modulari, da 21 a 115cm con molteplici

larghezze intermedie, creano il design dell’armadio

dando un nuovo ritmo visivo e, inoltre, l’innovativo

sistema di apertura delle ante cancella le maniglie

mimetizzando N.O.W. con l’architettura della parete,

oppure creando nuovi mood cromatici in armonia

con gli ambienti circostanti.

Nasce così una soluzione realmente al centimetro,

per le dimensioni ma anche per le sensazioni: ogni

fascia può assumere infatti un colore differente.

1

40BrochureMilano.indd 40 16-04-2009 13:33:43

Page 41: Lago News 2009

41

N.O.W.: comp. 101

Ante battenti e fi anchi

in vetro opaco bianco ed in

vetro lucido cocco e panna.

Hinged doors and sides

in bianco coloured matt

glass and cocco and panna

coloured bright glass.

L. 401,5 - H. 265 - P. 60,9

Prezzo a partire da/Price from

€ 5.240

Con la semplice pressione

della mano si crea una

depressione che permette di

aprire l’anta.

A new type of opening: the

door can be opened with a

simple push.

N.O.W.: comp. 105

Ante battenti e fi anchi in vetro

opaco bianco.

Hinged doors and sides in

bianco coloured matt glass.

L. 510,5 - H. 265 - P. 60,9

Prezzo a partire da/Price from

€ 6.690

N.O.W.: comp. 113

Ante scorrevoli e fi anchi

in vetro opaco nero e vetro

lucido bianco, lilla, paglia

e salvia.

Sliding doors and sides in

nero coloured matt glass and

bianco, lilla, paglia and salvia

coloured bright glass.

L. 348,3 - H. 265 - P. 66,7

Prezzo a partire da/Price from

€ 4.830

2

3

4

1

2

3

4

41BrochureMilano.indd 41 16-04-2009 13:34:21

Page 42: Lago News 2009

Un materasso avvolto come la cialda di un cono

gelato infi lato dentro una piccola base cilindrica

in legno. Questa è l’accogliente e pratica poltrona

HUGGY. La presa dell’anello di base stringe la

parte inferiore del materasso tenendolo unito

e creando una avvolgente seduta con morbidi

braccioli. Sfi lando la base, il materasso si srotola

automaticamente e diventa all’occorrenza un

comodo letto d’emergenza per ospiti; la base si

capovolge e diventa un utile comodino.

A mattress wrapped like the wafer of an ice-cream

cone inserted inside a small cylindrical wooden base.

This is the inviting and practical HUGGY armchair.

The hold of the base ring grips the lower part of

the mattress, holding it together and creating a

wrap-around seat with soft arms. By unscrewing

the base, the mattress is automatically unrolled and

when required becomes a comfortable emergency

bed for guests; when the base is turned upside-down

it becomes a useful night table.

Poltroncina HUGGY

HUGGY Armchair

Poltrona/Armchair

130x78x64

Materasso/Mattress

175x85

Base-comodino/Base-nigh table

D. 64 - H. 35 - Sp. 12

Prezzo a partire da/Price from

€ 910

1

1

HUGGYDesign Brit Leissler/Lagostudio

42BrochureMilano.indd 42 16-04-2009 13:36:13

Page 43: Lago News 2009

43

1

43BrochureMilano.indd 43 16-04-2009 13:37:11

Page 44: Lago News 2009

Giuliana Racco e Matteo Guidi IN ATTESA DI...A cura di Caterina Benvegnù

Un fotoromanzo che narra dello scorrere del

tempo di un’azienda, della scansione data dalla

frenesia di chi la fa pulsare, degli intrecci tra stati

di quiete e di moto, tra momenti di attesa e altri di

frenesia. Come i dipendenti vivono il loro tempo,

come riflettono su di esso, cosa attendono? Cosa

sperano? Chi verrà in contatto con la sala d’attesa

avrà modo di entrare in una dimensione parallela

alla realtà in cui si trova, portandosi così dentro

alle domande su come vivere l’attesa ed il proprio

tempo in un periodo che tende a porre a margine

e a devalorizzare questi momenti.

A photo story narrating the passing of time inside

a company, the rhythm given by the frenzy of

those who make it throb, the tangle created by

states of stillness and movement, by moments of

waiting and others of frenzy. How do employees

live their time, how do they reflect on it,

what are they expecting? What are they hoping

for? Those who get in contact with the waiting

room will be able to enter a parallel dimension

with respect to the reality they belong to, thus

bringing themselves inside the questions on how

to live the waiting process and their own time, in

a period which tends to marginalize and to deprive

those very moments of their value.

ART WAITING ROOM

9 Aprile 2009 - 14 Luglio 2009

Lun/Ven 8.30-12 e 14.30-18 Sab e Dom chiuso.

L’Art Waiting Room è il modo in cui LAGO ha

interpretato la propria sala d’attesa.

Progetto in collaborazione con: Fondazione March

LAGO S.p.A

Via dell’Artigianato ll n.21

35010 Villa del Conte, Padova, Italia

T +39.049.599.4299 F +39.049.599.4191

www.lago.it

[email protected]

44BrochureMilano.indd 44 16-04-2009 13:37:48