Full-length dysferlin expression driven by engineered human dystrophic blood derived CD133+ stem...

Full-length dysferlin expression driven by engineeredhuman dystrophic blood derived CD133+ stem cellsMirella Meregalli1, Claire Navarro2, Clementina Sitzia1, Andrea Farini1, Erica Montani3,Nicolas Wein2,4, Paola Razini1, Cyriaque Beley5, Letizia Cassinelli1, Daniele Parolini1,Marzia Belicchi1, Dario Parazzoli3, Luis Garcia5 and Yvan Torrente1

1 Fondazione IRCCS Ca Granda Ospedale Maggiore Policlinico, Centro Dino Ferrari, Milano, Italy

2 Inserm UMR-S 910 ‘Genetique Medicale et Genomique Fonctionnelle’, Facult�e de M�edecine de Marseille, Universit�e de la M�editerran�ee

Marseille, France

3 Imaging Facility IFOM Foundation – The FIRC Institute of Molecular Oncology Foundation, Milan, Italy

4 D�epartement de G�en�etique M�edicale, Hopital d’enfants de la Timone, Marseille, France

5 UFR des sciences de la sant�e Simone Veil, Universit�e Versailles Saint-Quentin, Montigny-le-Bretonneux, France

Keywords

dysferlin; exon skipping; gene therapy;

muscular dystrophy

Correspondence

Y. Torrente, Stem Cell Laboratory,

Dipartimento di Fisiopatologia medico-

chirurgica e dei Trapianti, Universit�a degli

Studi di Milano, Fondazione IRCCS Ca’

Granda Ospedale Maggiore Policlinico, Via

F. Sforza 35, 20122 Milan, Italy

Fax: 0039 02 55033800

Tel: 0039 02 55033874

E-mail: [email protected]

(Received 5 April 2013, revised 2

September 2013, accepted 4 September

2013)

doi:10.1111/febs.12523

The protein dysferlin is abundantly expressed in skeletal and cardiac

muscles, where its main function is membrane repair. Mutations in the

dysferlin gene are involved in two autosomal recessive muscular

dystrophies: Miyoshi myopathy and limb-girdle muscular dystrophy type

2B. Development of effective therapies remains a great challenge. Strategies

to repair the dysferlin gene by skipping mutated exons, using antisense

oligonucleotides (AONs), may be suitable only for a subset of mutations,

while cell and gene therapy can be extended to all mutations. AON-treated

blood-derived CD133+ stem cells isolated from patients with Miyoshi

myopathy led to partial dysferlin reconstitution in vitro but failed to

express dysferlin after intramuscular transplantation into scid/blAJ dysfer-

lin null mice. We thus extended these experiments producing the full-length

dysferlin mediated by a lentiviral vector in blood-derived CD133+ stem

cells isolated from the same patients. Transplantation of engineered blood-

derived CD133+ stem cells into scid/blAJ mice resulted in sufficient

dysferlin expression to correct functional deficits in skeletal muscle

membrane repair. Our data suggest for the first time that lentivirus-medi-

ated delivery of full-length dysferlin in stem cells isolated from Miyoshi

myopathy patients could represent an alternative therapeutic approach for

treatment of dysferlinopathies.

Introduction

Muscular dystrophies are a heterogeneous group of

inherited disorders characterized by progressive muscle

wasting and weakness; they present large clinical

variability regarding age of onset, patterns of skeletal

muscle involvement, heart damage, rate of progression

and mode of inheritance [1,2]. Molecular genetic

studies have revealed different causative mutations in

genes that encode proteins involved in all aspects of

muscle cell biology. Two clinical forms of autosomal

recessive muscular dystrophies – Miyoshi myopathy

(MM) and limb-girdle muscular dystrophy type 2B

(LGMD-2B) – arise from genetic defects in the

Abbreviations

AAV, adeno-associated virus; AON, antisense oligonucleotide; EGFP, enhanced green fluorescent protein; FACS, fluorescence activated cell

sorting; FISH, fluorescent in situ hybridization; LGMD-2B, limb-girdle muscular dystrophy type 2B; MM, Miyoshi myopathy; ntx, notexin;

PBMC, peripheral blood mononuclear cell; TA, tibialis anterior.

FEBS Journal 280 (2013) 6045–6060 ª 2013 FEBS 6045

dysferlin gene (DYSF; 2p13, GenBank NM_003494.2)

[3,4]. In addition to previously described symptoms,

mutations in DYSF are associated with a wide

spectrum of phenotypes, ranging from isolated

hyperCPKemia to severe disability [5]. Dysferlin is a

230-kDa protein that is abundantly expressed in

skeletal and cardiac muscles and plays a central role in

sarcolemmal repair [6]. Based on protein sequence

analysis, it was classified as a member of the ‘ferlins’

family, sharing a common multiple-motif C2 domain

and one transmembrane domain in the C-terminal part

of the protein [7–9]. To date, the reported DYSF gene

mutations include point mutations, small deletions and

insertions, distributed throughout the entire coding

sequence. No hotspots have been identified, and

missense, nonsense and frameshift mutations have

been reported [10,11].

Although no therapy is available for muscular

dystrophies, different studies have demonstrated that

transcript rescue is a feasible approach in dystrophinop-

athies. Since the work of Lu and colleagues that

demonstrated how exon skipping was a good technique

to bypass nonsense mutation into mdx mouse [12], the

group of Aartsma-Rus confirmed the feasibility of exon

skipping into human Duchenne muscular dystrophy

cells [13] while Goyenvalle and co-workers showed that

U7 small nuclear RNA mediated exon skipping rescues

the dystrophic muscle [14]. All this evidence lead to

recent clinical trials [15]. This technique uses specific

antisense oligonucleotides (AONs) to skip one or several

exons carrying disease-causing mutations in order to

obtain an in-frame functional protein [14,16,17]. Unfor-

tunately, it is only applicable for proteins in which part

of the amino acid sequence can be deleted without

important deleterious impact on their overall function.

In the dysferlin gene, it may be possible to skip some

exons in the functionally redundant C2 domains, such

as exon 32 [18,19], but not others, such as exons 53 and

54 that encode the unique terminal transmembrane

domain [20]. Other techniques complementary to the

exon skipping approach include the use of adeno-associ-

ated viruses (AAVs) to carry wild-type cDNA of specific

mutated genes and perform gene replacement [21,22]

and/or the use of gene miniaturizing and transplicing

approaches to overcome the packaging limits of AAVs

[23,24]. Promising results have been obtained with mini-

gene replacement [25,26], and Grose et al. were able to

deliver a cassette with an optimized dysferlin cDNA

using AAV5. Following AAV5 transfer in an animal

model, they produced the dysferlin full-length transcript

and protein, with expression levels sufficient to correct

functional deficits in diaphragm muscle and in skeletal

muscle membrane repair [27].

Additionally, stem cells alone or, better, combined

with gene correction methods have received much

attention for their potential use in therapies for human

degenerative diseases [28–30]. In 2004, our group

isolated from human blood a subpopulation of

CD133+ stem cells that, when transplanted into a

DMD animal model (the scid/mdx mouse), restored

dystrophin expression, participated in skeletal muscle

regeneration and regenerated the satellite cell pool

[31]. Recently, dystrophic CD133+ stem cells were

transduced with a lentivirus carrying a construct

designed to skip exon 51 of dystrophin; following

transplantation into scid/mdx mice, they fused in vivo

with regenerative fibers, restructuring the dystrophin-

associated protein complex [32].

In the present work, we isolated blood-derived

CD133+ stem cells from two patients carrying different

mutations in the dysferlin gene. The first patient had

two mutant alleles (one deletion of exon 22 and one

large deletion between exons 25 and 29), while the

second patient had a homozygous deletion of exon 55.

We verified the feasibility of rescuing dysferlin of

blood-derived CD133+ stem cells isolated from the

first patient by means of exon skipping using AONs.

AON-treated blood-derived CD133+ stem cells failed

to express dysferlin in vivo after transplantation into

immune/dysferlin-deficient scid/blAJ mice [33]. These

data together with the ineligibility for exon skipping of

the second patient (lacking exon 55) prompted us to

design a lentivector for expression of the full-length

dysferlin transcript. We showed that such a vector

allowed dysferlin expression of blood-derived CD133+stem cells isolated from MM patients to correct

functional deficits in skeletal muscle membrane repair

of transplanted scid/blAJ mice.

Results

Patient phenotype and genotype description

This study included patients exhibiting a typical MM

phenotype. Patient 1 was a 34-year-old man diagnosed

with MM at the age of 17 years. At the time of diag-

nosis, his right quadriceps muscles showed evidence of

a myopathic pattern with fiber size variability,

increased connective tissue, necrosis and interstitial

cellularity. Immunostaining of peripheral blood mono-

nuclear cells (PBMCs) (Fig. 1C) and western blot

analysis (Fig. 1E) showed an absence of DYSF

protein. We isolated CD14+ mononuclear cells from

the patient’s PBMCs to perform detailed genetic

analyses of the DYSF gene. Exploration of the entire

DYSF coding sequence and intronic boundaries

6046 FEBS Journal 280 (2013) 6045–6060 ª 2013 FEBS

Dysferlin rescue by CD133+ cell transplantation M. Meregalli et al.

http://www.ncbi.nlm.nih.gov/protein/NM_003494.2

resulted in the identification of one deletion in exon

22, leading to a premature codon stop (c.2077delC,

p. His693Thrfs*). A second mutation was identified

using genomic quantitative real-time PCR; it consisted

of a large genomic deletion encompassing exons 25–29and was predicted to cause an in-frame deletion

(p.Tyr838_Arg1058del) [10]. The absence of protein

observed in western blot and immunofluorescence

analyses suggested a destabilization and/or degrada-

tion of this predicted in-frame truncated RNA or pro-

tein. RT-PCR was performed in order to detect a

shorter in-frame mRNA. Surprisingly, we failed to

amplify the deleted mRNA using primers located

around the deletion (namely, in exons 20 and 31), and

we amplified only the allele carrying the exon 22 dele-

tion (Fig. 1A). We designed primers overlapping the

junction 24–30, specific for the allele carrying the large

deletion, but still observed no amplification (Fig. 1B).

Patient 2 was a 45-year-old man who was diagnosed

with MM at 22 years of age. At the time of diagnosis,

his right quadriceps muscles showed evidence of a

myopathic pattern with necrosis and an increased

interstitial cellularity. RT-PCR analysis confirmed the

presence of dysferlin mRNA in patient 2 (Fig. 1D),

whereas immunostaining of PBMCs (Fig. 1C) and

western blot (Fig. 1E) showed an absence of dysferlin

protein. Gene sequencing showed a homozygous dele-

tion of exon 55 (c.6233_6240delCCTTCAGC,

p.Pro2078Leufs*92) of the DYSF gene, causing a stop

codon.

Feasibility of exon skipping of exons 22–23,25–29, 22–29 of the DYSF gene

To verify the feasibility of an exon skipping

approach in patient 1, we constructed several deleted

dysferlin cDNAs. We obtained a dysferlin protein

fused to the C-terminal part of enhanced green fluo-

rescent protein (EGFP) in the N-terminal of the pro-

tein, allowing its expression in mammalian cells. The

exons of interest were confirmed to be deleted,

including 22–23, mimicking the skipping of the muta-

tion of one allele of patient 1; 25–29, mimicking the

skipping of the mutation in the second allele of

patient 1; and 22–29, to investigate the possibility of

skipping a high number of exons. We transfected

full-length and deleted D22–23, D25–29, D22–29 dys-

ferlin plasmids into HEK cells, to evaluate produc-

tion of the deleted dysferlin proteins. Then 48 h after

transfection we measured the percentage of dead cells

(respectively, full-length dysferlin 5.1%; non-transfect-

ed cells 1.9%; D22–23 18.8%; D25–29 14.4%; D22–2918.7%) and the percentage of the EGFP signal by

fluorescence activated cell sorting (FACS), confirming

the expression of truncated EGFP-dysferlin plasmid

and the efficiency of transduction (Fig. 2A). RT-PCR

analysis from transfected HEK cells showed the

expression of dysferlin mRNA for all of the trun-

cated isoforms (Fig. 2B). These data were validated

by western blot analysis: we identified the full-length

dysferlin protein corresponding to a molecular weight

of ~ 268 kDa and other truncated dysferlins charac-

terized by lower molecular weights (Fig. 2C). Fur-

thermore, the expression of the deleted form D22–29demonstrated that all exons between 22 and 29 could

A C

B

D

E

Fig. 1. Dysferlin expression in MM patients. (A) RT-PCR analysis of

PBMCs isolated from patient 1 showing mRNA amplification of the

allele carrying exon 22 with deletion but no mRNA amplification of

the allele carrying the large in-frame deletion 25–29 (Fwd ex20/Rev

ex31F). (B) RT-PCR analysis of PBMCs isolated from patient 1

showing no amplification of the large deleted allele 25–29; primers

overlap the junction 24–30 (Hdysf24-30-F/Hdysf31-R). A control

plasmid mimicking deletion was used as positive control for

primers. (C) Immunohistochemistry of the total fraction of PBMCs

isolated from control – showing dysferlin expression (brown

stained) and its localization – and from patients 1 and 2, showing

dysferlin absence (counterstained with hematoxylin). (D) RT-PCR

analysis of PBMCs isolated from patient 2, showing the presence

of dysferlin transcript. (E) Western blot analysis confirming the

absence of dysferlin protein in PBMCs of patients 1 and 2. Human

healthy PBMCs were used as positive control.


M. Meregalli et al. Dysferlin rescue by CD133+ cell transplantation

be removed to produce a truncated protein (Fig. 2C).

Unfortunately, the same approach could not be used

to create a D51–55 EGFP dysferlin, mimicking the

skipping of the mutation of patient 2, because this

block of exons encodes two crucial elements, the 3′UTR sequence and the transmembrane domain of

the protein [20].

Restoration of dysferlin expression in vitro by

AONs and lentivirus full-length DYSF

Both exons 22 and 23 had to be removed to restore

an ORF and to allow the production of a ‘truncated’

but functional protein that could ameliorate the clini-

cal phenotype (Fig. 3A). According to previously

reported data [34,35], several regions of both exons

were analyzed with regard to recognizing exon splic-

ing enhancer in addition to the donor/acceptor splice

sites and allowing the skipping of targeted exons.

After AON treatment of normal human myoblasts,

RT-PCR analysis encompassing exons 22 and 23 was

performed using a combination of primers located

from exon 20 to exon 26 to ensure amplification of

shorter fragments carrying an exon 22–23 deletion or

larger ones, as described in previous studies [36,37].

We observed several skipped products corresponding

to deletions of exon 23 alone, exons 22 and 23, exons

22–24, or exon 24 alone (Fig. 3A). In both treated

and untreated samples, we observed deletion of exon

24 alone (data not shown). This unexpected skipped

product suggested an alternative transcript expressed

at very low level in myoblasts in culture. The AON

treatment of blood-derived CD133+ stem cells iso-

lated from patient 1 led to the expression of a

skipped dysferlin (D22–24) with a low efficiency

(Fig. 3A).

We next developed a strategy based on complete

dysferlin delivery by lentiviral vector. Importantly,

this approach represented a valid alternative to exon

skipping technology for the treatment of patient 2,

for whom we could not remove the exons located in

the C-terminal part of the protein (such as exons

51–55) because their removal would impair dysferlin

protein expression and function [20]. Moreover, other

regions required skipping of three or more exons to

restore a correct ORF, a result hardly obtainable

with a classical exon skipping strategy, as we showed

in patient 1. To overcome these limitations, we subcl-

oned the complete dysferlin transcript into a lentivi-

ral pRRL backbone and tested its efficiency in

blood-derived CD133+ cells isolated from patients 1

and 2. We constructed a lentiviral vector (pRRL-

SINPPTPGK H dysferlin WPRD, or LV-FL DYSF)

in which expression of human full-length dysferlin

cDNA was driven by human PGK1 promoter. We

used RT-PCR analysis to test the LV-FL DYSF

transduction efficiency on CD133+ stem cells isolated

from the patients. Total mRNAs from engineered

CD133+ stem cells were analyzed by nested RT-PCR

to confirm the presence of a full-length DYSF tran-

script (Fig. 3C). To further analyze the LV-FL

DYSF transduction efficiency we synthesized a

A

B C

Fig. 2. Feasibility of exon skipping of DYSF gene. (A) HEK GFP+ cells after transfection with dysferlin plasmids (% of GFP+ cells: full-length

dysferlin, 40.3%; not-transfected cells, 0.2%; D22–23, 16.4%; D25–29, 26.6%; D22–29, 15.5%). (B) RT-PCR analyses on transfected HEK

cells with full-length and truncated dysferlin (1, full-length dysferlin; 2, not-transfected cells; 3,D22–23; 4, D25–29; 5, D22–29). (C) Western

blot analysis of transfected cells with full-length and truncated dysferlin.



second lentiviral vector using the same pRRL back-

bone subcloned with GFP transcript. Our lentivirus

construction recapitulates the transduction efficiency

of previously tested and published lentivirus vectors

[38,39]. We performed FACS analysis to determine

the expression of GFP in infected CD133+ normal

blood derived cells and we showed a percentage of

60.9% of GFP positive cells demonstrating a good

efficiency of transduction as previously described

[40,41] (Fig. 3B).

A

B C

(a)

(b) (e)

(c)

(d)

(a)

(b)

(c)

(d)

(e)

Fig. 3. Construction of AON and LV-FL DYSF for restoration of dysferlin expression. (A) Scheme of AON design for skipping mutation in

patient 1. Efficiency of exon skipping in transfected normal human myoblasts was verified by RT-PCR analysis using a combination of

different primers. PCR products were sequenced to confirm ligation between the exons after the skipping [1, molecular weight marker; 2,

not transfected human myoblasts; 3, myoblasts transfected without AONs (24 h); 4, myoblasts transfected with HDysf22-1; 5, myoblasts

transfected with HDysf23-2; 6, myoblasts transfected with HDysf23-1 (48 h) showing no exon skipping; 7, myoblasts transfected with

HDysf23-1 and HDysf23-2 (24 h) showing exon 23 skipping; 8, myoblasts transfected with HDysf22-1 and HDysf23-2 (24 h) showing no

exon skipping; 9, myoblasts transfected with HDysf22-1 and HDysf23-1 (24 h) showing no exon skipping; 10, myoblasts transfected with

HDysf23-2 and HDysf23-1 (48 h) showing exon 22 and 23 in-frame skipping and exon 23 and 24 skipping; 11, myoblasts transfected with

HDysf23-2 and HDysf23-1 showing exon 24 skipping; 12, molecular weight marker; 13, blood-derived CD133+ stem cells from patient 1

transfected with HDysf22-2, HDysf23-3, HDysf23-1; 14, blood-derived CD133+ stem cells transfected without AONs]. (B) Determination of

lentiviral transduction efficiency. FACS analysis on healthy human blood-derived CD133+ cells transduced with LV-GFP show 60.9% GFP+

cells. (C) RT-PCR showing the restoration of dysferlin expression in CD133+ patients’ cells after LV-FL DYSF infection (1, CD133+ cells from

patient 1; 2, CD133+ cells from patient 2; 3, normal human CD133+ cells; 4, CD133+ LV-FL DYSF cells from patient 1; 5, CD133+ LV-FL

DYSF cells from patient 2).



Failure of dysferlin expression after engraftment

of AON-treated blood-derived CD133+ stem cells

isolated from MM patients

We injected 2 9 105 AON-treated blood-derived

CD133+ stem cells isolated from patient 1 into the tib-

ialis anterior (TA) of 5-month-old scid/blAJ mice (two

groups of n = 5 for patient cell batch) after verifying

the expression of a truncated dysferlin by RT-PCR

(Fig. 3A). At 72 h after the injection, human a-centro-meric positive fibers were detected in all injected

muscles, but dysferlin was not detected at the surface

of these human a-centromeric positive fibers (data not

shown). One month after the intramuscular transplan-

tation of AON-treated blood-derived CD133+ stem

cells isolated from patient 1 (n = 5), we did not

observe the presence of dysferlin positive myofibers.

In vivo restoration of dysferlin expression in

mouse after intramuscular delivery of LV-FL

DYSF blood-derived CD133+ stem cells isolated

from MM patients

As we obtained dysferlin expression in vitro, we tested

the ability of blood-derived CD133+ stem cells isolated

from patients 1 and 2 that were transduced with

LV-FL DYSF to restore dysferlin expression in mus-

cles of scid/blAJ mice. We performed a single intra-

muscular injection of 2 9 105 engineered cells in the

untreated (n = 4) or notexin (ntx) pretreated TA of

5-month-old scid/blAJ mice (n = 9). Ntx injection was

used to allow the regenerating fibers to increase the

fusion of the human engineered blood-derived

CD133+ stem cells. Moreover, ntx pretreatment exac-

erbated the pathology of scid/blAJ mice that show a

less severe phenotype than the A/J dysferlin-null mice

[42]. One month after the transplantation, clusters of

human a-centromeric positive fibers were detected in

transverse muscle sections, presumably located near

the injection sites, with a higher percentage in ntx-

treated than untreated muscles (29.5 � 3.77 versus

5.14 � 2.15 of human positive nuclei per section)

(Fig. 4A). The presence of human dysferlin was thus

investigated in ntx-pretreated muscle sections of scid/

blAJ dysferlin-null mice. Human dysferlin was detected

in a patchy distribution of the muscle fibers of trans-

planted scid/blAJ mice (37.2 � 5.60 of human positive

dysferlin myofibers per section; < 10% of total myofi-

bers) (Fig. 5). The majority of human dysferlin posi-

tive myofibers co-express human a-centromeric

positive fibers (Fig. 5A). Human dystrophin expression

was detected on serial sections using the NCL-Dys3

antibody (39.7 � 3.58 of human positive dystrophin

myofibers per section; < 10% of total myofibers)

(Fig. 4B). RT-PCR analysis detected dysferlin expres-

sion in all treated muscles (Fig. 5B). Western blot

analysis confirmed the findings previously described

and showed expression of the dysferlin protein in all

transplanted dystrophic muscles (Fig. 5C). To analyze

whether the dysferlin restoration after intramuscular

transplantation of engineered blood-derived CD133+stem cells isolated from patients 1 and 2 was associ-

ated with improvement of muscle health, we investi-

gated the tissue characteristics of treated muscles.

Unfortunately, the injected muscles showed dystrophic

features similar to untreated muscles given that there

are no differences in the percentage of centronucleated

fibers (7.466 � 2.02 in injected scid/blAJ mice and

8.52 � 2.9 in untreated scid/blAJ mice; n = 9). In

order to exclude less efficiency of in vivo engraftment

of engineered stem cells we verified the success of

intramuscular transplantation on scid/blAJ dysferlin-

null mice of human blood-derived CD133+ stem cells

isolated from healthy subjects. The number of human

dysferlin positive muscle fibers in transplanted scid/

blAJ mice was similar to the number obtained after

transplantation of engineered blood-derived CD133+stem cells (39.8 � 7.13 of human positive dysferlin

myofibers per section; < 10% of total myofibers). Clus-

ters of human dystrophin positive myofibers were also

found (41.2 � 1.71 of human positive dystrophin

myofibers per section; < 10% of total myofibers). The

percentage of centronucleated fibers (8.104 � 1.10 in

injected scid/blAJ mice and 8.36 � 2.4 in untreated

scid/blAJ mice; n = 9) and dystrophic features of

human blood-derived CD133+ stem cell injected mus-

cles were similar to untreated dystrophic muscles.

Functional assays

As dysferlin absence causes a defect in membrane

repair, we tested the ability of single fibers from trans-

planted muscles to reseal the membrane after laser

wounding, as previously described by Bansal et al. [7].

Laser wounding experiments were performed in the

presence of FM-143 dye on single fibers isolated from

the TA of injected and non-injected scid/blAJ mice.

FM-143 fluoresces more brightly in a lipid environ-

ment; thus, in membranes that are wounded but not

healed, the fluorescence increases as the FM-143

entering the sarcolemma binds to internal membranes.

When the membrane damage is resealed, further

intracellular entry of the dye is blocked and the

fluorescence stops increasing. Single muscle fibers

isolated from transplanted scid/blAJ mice which

received the AON-treated blood-derived CD133+ stem



cells showed similar behavior after the laser wounding

assay compared with the results with not-treated dys-

trophic scid/blAJ mice (data not shown). We thus

administered a single injection of 2 9 105 engineered

LV-FL DYSF blood-derived CD133+ stem cells iso-

lated from patients 1 and 2 into the TA of 5-month-

old scid/blAJ mice (two groups of n = 5 for patient

cell batch). At 1 month after the injection, human

a-centromeric nuclei and human dysferlin double posi-

tive fibers were easily detected in all TA injected mus-

cles but not in not-injected TA contralateral muscles

(data not shown). Single fibers (n = 100) from control

c57Bl mice (n = 5), untreated scid/blAJ mice (n = 5)

and transplanted scid/blAJ mice (n = 5) were isolated

and plated in dishes with Ca2+ NaCl/Pi. In all cases, a

patch of fluorescence formed within 10 s after the

damage at the lesion site (Fig. 6A). Full videos for

treated and untreated mice can be downloaded from

http://www.mediafire.com/download/9gao6v6no6t4gno/

Scid-AJ_LV-DYSF.avi and http://www.mediafire.com/

download/rf2bjcdjrffkkro/Scid-AJ_untreated.avi. It is

known that the increase in signal intensity rapidly

stops in wild-type dysferlin positive fibers, whereas it

continues to augment in dysferlin negative fibers [7].

A

B

Fig. 4. In vivo injection of patient CD133+

cells genetically modified with a lentivirus

coding for full-length dysferlin (LV-FL

DYSF). (A) FISH analysis on TA muscles of

scid/blAJ mice injected with patients’

CD133+ LV-FL DYSF and on human

normal muscle showing the presence of

human nuclei stained with an

a-centromeric probe (in red) as indicated

by arrows. In the lower panel, the TA

muscle of not transplanted scid/AJ mouse

represents the negative control. (B)

Immunofluorescence analysis of murine

muscle injected with patients’ blood-

derived CD133+ LV-FL DYSF cells for the

expression of human dystrophin. Human

dystrophin expression was detected on

serial sections using the NCL-Dys3

antibody.



http://www.mediafire.com/download/9gao6v6no6t4gno/Scid-AJ_LV-DYSF.avi

http://www.mediafire.com/download/9gao6v6no6t4gno/Scid-AJ_LV-DYSF.avi

http://www.mediafire.com/download/rf2bjcdjrffkkro/Scid-AJ_untreated.avi

http://www.mediafire.com/download/rf2bjcdjrffkkro/Scid-AJ_untreated.avi

Here we found that the increase of the signal was

much lower in the engineered LV-FL DYSF blood-

derived CD133+ stem cell transplanted fibers from the

scid/blAJ mice than from the untreated mice

(P < 0.0001); notably, the trend of the curve for trea-

ted samples resembled that of control samples

(Fig. 6A). For all experiments, we plotted the intensity

of fluorescence coming into the fibers versus seconds.

After the laser damage experiments single fibers were

collected and total mRNA was extracted. RT-PCR

analysis was performed to analyze dysferlin expression

in treated samples. We confirmed that only the single

fibers which expressed dysferlin were able to repair

the membrane damage after laser wounding, while the

absence of dysferlin expression correlated with the

absence of differences in fluorescence intensity

(Fig. 6B).

Discussion

Autosomal recessive forms of muscular dystrophy

include clinically divergent LGMD-2B and distal MM.

Although distinct in terms of weakness onset pattern,

both disorders arise from defects in the gene encoding

dysferlin [43]. Since the discovery of the dysferlin gene

in 1998 [44], mutational analyses in dysferlinopathy

patients have revealed mostly single nucleotide

changes, without mutational hotspots or any obvious

correlation between genotype and distribution of mus-

cle weakness [19]. This wide spectrum of identified

DYSF mutations increases the difficulty of finding fea-

sible treatments for these diseases. While the exon

skipping technique has opened interesting new avenues

for DMD treatment [14,16,17,45], it has been clearly

demonstrated that several dysferlin exons could not be

skipped as their suppression would be undoubtedly

deleterious [46,47]. Surprisingly, in 2006, Sinnreich

et al. reported a positive genotype–phenotype correla-

tion in an LGMD-2B family with two severely affected

sisters and a mildly affected mother. Furthermore, the

mother carried a lariat branch point mutation in

intron 31 that allowed an in-frame skipping of exon 32

[19]. Taking these findings as a proof of principle

for the feasibility of skipping exon 32, Wein et al.

A

B C

Fig. 5. Rescue of dysferlin expression

after in vivo injection of engineered

CD133+ cells. (A) FISH analysis of scid/

blAJ muscles injected with patients’

CD133+ LV-FL DYSF, showing human

nuclei stained with an a-centromeric probe

(in red) and the rescue of dysferlin protein

expression at the plasma membrane (in

green). (B) RT-PCR analysis of murine

muscle injected with patients’ blood-

derived CD133+ LV-FL DYSF for the

detection of dysferlin and human GAPDH

mRNA (NI, scid/blAJ mouse not injected).

(C) Western blot analysis of muscles

isolated from scid/blAJ mice injected with

blood-derived CD133+ LV-FL DYSF

isolated from both patients, confirming the

expression of dysferlin protein. C57Bl

mouse was used as control.



demonstrated in a dysferlinopathic patient that exon

32 was efficiently skipped using AONs without conse-

quences on protein function [20].

In the present study, we investigated this approach in

dysferlinopathies by first isolating blood-derived

CD133+ stem cells from two patients: patient 1 with two

mutated alleles (deletions in exon 22 and in exons

25–29) and patient 2 with a homozygous deletion of

exon 55. To verify the feasibility of the exon skipping

approach in patient 1, we constructed several dysferlin

deletion cDNAs (D22–23, D25–29, D22–29). We found

that all exons between 22 and 29 could be removed

safely. In particular, it was necessary to remove exons

22–23 to restore an ORF. Unfortunately, the exon skip-

ping efficiency was low in myoblasts and blood-derived

CD133+ stem cells and did not lead to the in vivo

expression of dysferlin after intramuscular transplanta-

tion of AON-treated blood-derived CD133+ stem cells.

Moreover, the functional assays performed on dystro-

phic scid/blAJ muscles treated with AON-treated

blood-derived CD133+ stem cells confirmed the failure

of this approach. To enhance skipping efficiency, addi-

tional AONs encompassing larger and/or different

target regions should be tested, individually or in combi-

nation with the AONs used here.

A gene transfer approach could be an alternative

route for treating recessive diseases such as dysferlinop-

athy. Millay et al. showed that replacement of the

dysferlin gene in AJ mice completely rescued muscle

pathology and fully restored muscular force [48]. The

AAV vector is the most commonly used viral vector in

muscle gene therapy; however, there are major technical

issues associated with using AAV in therapeutic

approaches, including the limited packaging size of

AAV vectors, which is below the size of dysferlin

mRNA. Interestingly, Grose et al. recently described

AAV5 dysferlin delivery as a promising therapeutic

approach that could restore functional deficits in

dysferlinopathic patients [27]. As is well known from

previously published work, dysferlin exons 51–55

A

B

Fig. 6. Functional analysis of treated mice. (A) Membrane repair assay of single fibers isolated from TA muscles of injected and non-injected

mice. Images were taken before laser wounding (t = 0) and every 30 s after laser wounding. scid/blAJ control mice showed continuous

entry of fluorescent dye after laser damage (lane 1), while in mice transplanted with CD133+ LV-FL DYSF membrane resealing stopped the

dye entry (lane 2). Graph shows fluorescence intensity, measured in the damaged area, plotted against time. C57Bl mice were used as a

positive control of membrane release ability. All images were taken with the Leica TCS SP5 confocal microscope at 639 magnification. (B)

RT-PCR analysis on single myofibers collected after membrane repair experiments showed dysferlin expression in treated samples (1,

molecular weight marker; 2, not injected scid/blAJ; 3, scid/blAJ muscles injected with patients’ CD133+ LV-FL DYSF; 4, control human

myoblasts). Human healthy myoblasts were used as positive control and no dysferlin expression was seen in untreated samples.



encode the C-terminal part of the protein, which has a

fundamental role in anchoring dysferlin at the mem-

brane and cannot be eliminated without impairing pro-

tein function [20]. Here, we developed a strategy based

on delivery of full-length dysferlin by lentiviral vector to

allow dysferlin expression in both patients 1 and 2. We

created a lentivirus carrying the full-length dysferlin

gene (LV-FL DYSF) and we demonstrated the expres-

sion of dysferlin from transduced blood-derived

CD133+ stem cells isolated from both patients. After

transplantation of these cells into scid/blAJ mice, we

detected the expression of dysferlin mRNA and protein

in murine muscles; moreover, we noted normal resealing

activity of isolated single fibers from transplanted scid/

blAJ mice compared with the non-transplanted ones.

Unfortunately, this effect was not sufficient to restore

the dystrophic murine phenotype in vivo. A recent study

by Lostal et al. showed that myoferlin and a mini-dys-

ferlin could compensate for dysferlin deficiency in an

in vitro assay of sarcolemmal repair; however, they

could not rescue in vivo muscular defects associated

with dysferlin absence [49]. These findings suggested

that muscular pathology in dysferlinopathies may be

related not only to a membrane fusion defect but also to

vesicle trafficking and inflammation. From this point of

view, combining cell therapy (to replace dystrophic

fibers and reduce the inflammatory environment) with

gene therapy (to prevent further muscular damage)

could represent a promising approach to treat dysferlin-

opathies. Moreover, the use of human stem cells in our

in vivo animal studies obliges us to select as target ani-

mal model the scid/blAJ mice that show a less severe

phenotype than the A/J dysferlin-null mice. The per-

centage of dystrophin positive fibers obtained after

blood-derived CD133+ stem cells in scid/blAJ mice,

however, was lower than the percentage of dystrophin

positive fibers usually observed following the transplan-

tation of those cells in scid/mdx mice [31,32]. This result

suggested that blood-derived CD133+ stem cell trans-

plantation is less efficient in scid/blAJ mice than in scid/

mdx. We argued that the cells needed the presence of a

strong dystrophic environment to rescue the dystrophic

features. However, the cells have an advantage in com-

parison with other sources of myogenic stem cells that

possess muscle regenerating capacities, such as mesoan-

gioblasts: they are easily isolated from the blood of dys-

trophic patients at different times representing an

accessible tool to develop and test novel therapeutic

approaches with major impact on research costs and

number of treated patients. Our present study provides

a proof of principle of the feasibility of using engineered

CD133+ blood stem cells in dysferlinopathy treatment.

Further studies will be needed to better elucidate the

efficacy of our approach with increasing number of

transplanted cells and different methods of delivery [50–52]. However, the present results contribute to improve

translational research on the treatment of dysferlinopa-

thies using stem cells engineered with a LV-FL DYSF,

such as future testing of other cell types that possess

robust myogenic potency.

Materials and methods

Patient genotyping

Human samples were collected after obtaining signed

informed consent from all participants according to the

guidelines of the Committee on the Use of Human Sub-

jects in Research of the Fondazione IRCCS Ca’ Granda

Ospedale Maggiore Policlinico di Milano (Milan, Italy).

This study was approved by the ethics committee of the

University of Milan, Italy (CR937-G), which also autho-

rized the use of human blood and muscle tissues. CD14+cells were isolated from two patients who suffered from

MM. Genomic DNA was extracted from peripheral blood

lymphocytes by standard procedures [53]. In the first

patient we found a 4-bp deletion in exon 22 leading to a

premature codon stop (c.2077delC, p.His693Thrfs*), and

in the second patient we found a homozygous deletion of

exon 55 (c.6233_6240delCCTTCAGC, p.Pro2078Leu-

fs*92). Total RNA was extracted with TRIzol reagent

(Invitrogen Life Technologies, Carlsbad, CA, USA) fol-

lowing the manufacturer’s protocol. The cDNAs were

prepared using Superscript III First Strand Reverse

Transcriptase (Invitrogen Life Technologies, Carlsbad,

CA, USA) following the recommendations of the manu-

facturer. To identify the large deletion in patient 1, we

performed RT-PCR using a forward primer located in

exon 20 and a reverse primer located in exon 31. Internal

primers overlapping abnormal junction 24–30 were used

to amplify the mRNA carrying a large deletion. All other

primers used are available upon request. Sequencing reac-

tions were performed with a dye terminator procedure,

using a capillary automatic sequencer CEQTM 8000 (Beck-

man Coulter, Brea, CA, USA) according to the manufac-

turer’s recommendations. The large deletion was delimited

using Genomic Quantitative Real-Time PCR with specifi-

cally designed TaqMan® or SYBR-GREEN® assays

(Applied Biosystems, Foster City, CA, USA) as previ-

ously reported by Krahn et al. [10]. Sequence variations

are described according to den Dunnen’s recommenda-

tions: http://www.hgvs.org/mutnomen.

Dysferlin plasmid construction

As proof of principle of exon skipping feasibility, we tested

whether the skipped dysferlin product (D22–23) could be



http://www.hgvs.org/mutnomen

correctly expressed. From the GFP-DFL plasmid (a kind

gift from K. Bushby) – which contains the complete dysfer-

lin cDNA cloned into the pcDNA4/TO/MycHIS vector

[54] – we subcloned an EcoRI-AfeI fragment into a smaller

vector (p-Shuttle) to allow PCR amplification using the fol-

lowing primer combinations: HdysF21-R/Hdysf24-F and

Hdysf24-R/Hdysf30-F (Table 1). After verification of dele-

tion by enzyme restriction and direct sequencing, the puri-

fied fragment EcoRI-AfeI was cloned back into the initial

vector by homologous recombination, resulting in a plas-

mid encoding a D22–23 dysferlin protein fused to EGFP at

the N-terminal. Additional plasmids encoding other trun-

cated forms of dysferlin (D25–29, D22–29) were produced

using the same approach. Dysferlin plasmid GFP-DFL

contained unique cutting sites for both EcoRI and AfeI,

before the ATG initiation codon and in exon 35, respec-

tively. PCR products were ligated with the Quick Ligase

Kit (Promega, Madison, WI, USA) and transformed in

XL10-Gold Ultracompetent Cells (Invitrogen Life Technol-

ogies, Carlsbad, CA, USA). Isolated clones were digested

with HindIII and XbaI restriction enzymes, and the clones

showing the expected digestion pattern were sequenced to

verify correct deletion and absence of mutations.

By homologous recombination in BJ5183 bacteria,

deleted fragments were cloned back into the original

plasmid. Briefly, the original plasmid was cut with BstEII

(two different cutting sites), and the deleted insert was cut

with EcoRI and AfeI. Both linear fragments were purified

on agarose gel (Promega). We mixed 26 ng plasmid and

90 ng insert with BJ5183 bacteria and performed transfor-

mation by thermal shock. Several clones were amplified by

bacterial mini-culture, and plasmid was extracted using the

plasmid DNA extraction kit (Macherey-Nalgen, Duren,

Germany). To obtain a sufficient quantity of plasmid

DNA, each clone was used to transform XL10-Gold

bacteria; plasmid DNA was then verified by enzymatic

digestion and sequenced. This unusual method was applied

because strong plasmid recombinations occurred with clas-

sical ligation procedures.

HEK transfection with dysferlin plasmids

HEK cells (LGC Standards, Queens road Teddington,

Middlesex, Oly, UK) were maintained in DMEM supple-

mented with 10% fetal bovine serum and penicillin-Strepto-

myces. HEK cells were seeded at 1.5 9 105 cells per well in

a 24-well plate, grown for 20 h and transfected with pEG-

FP dysferlin plasmids. The transfection mixtures for each

sample contained 2 lL of Lipofectamine (Invitrogen Life

Technologies, Carlsbad, CA, USA) and 1.5 lg pEGFP dys-

ferlin plasmid in a 100-lL total volume of DMEM (Invi-

trogen Life Technologies, Carlsbad, CA, USA) without

antibiotics and fetal bovine serum. FACS and western blot

analyses were performed 48 h after transfection.

FACS analysis

A Cytomics FC500 flow cytometer and CXP 2.1 software

(Beckman Coulter, Brea, CA, USA) were used to visualize

3 9 104 GFP and HEK cells. Each analysis included at

least 10 000–20 000 events for each gate. A light-scatter

gateway was set up to eliminate cell debris from the analy-

sis. The percentage of positive cells was assessed after cor-

rection for the percentage reactive to an isotype control

conjugated to fluorescein isothiocyanate. Transfection was

highly efficient for all tested plasmids, as demonstrated by

the expression of the GFP reporter gene.

RT-PCR and western blot analyses

Truncated dysferlin D22–23, D25–29 and D22–29 isoforms

mimicking the skipped allele of our patient were detected

by RT-PCR and western blot analyses. Total RNA was

extracted from cells, muscles and single fibers using TRIzol

reagent. First-strand cDNA was prepared as previously

described [32]. To detect dysferlin mRNA, nested RT-PCR

was carried out with 1 lg cDNA. For the first amplifica-

tion, the final mix (Invitrogen Life Technologies, Carlsbad,

CA, USA) consisted of 19 Taq buffer, 1.5 mM MgCl2,

0.2 mM dNTP mix, 2.5 units Platinum Taq DNA polymer-

ase and 0.2 mM Hex20-F and 0.2 mM Hex26-R for full-

length dysferlin and D22–23, and not treated or Hex20-F

and 0.2 mM of Hex31-R for D25–29 and D22–29 (Table 1).

PCR conditions were as follows: 36 cycles of 94 °C for

1 min, 58 °C for 1 min and 72 °C for 1 min. PCR products

were purified using the Jetquick PCR Product Purification

Spin Kit (Genomed, Lohne, Germany). The second round

of amplification used 5 lL of purified PCR product and

Table 1. List of primers

Primer name Sequence

HdysF21-R CAGCCGGTCAGCAATCCCAAGCAGC

Hdysf24-F CCCCAGAACAGCCTGCCGGACATCG

Hdysf24-R TTTCAGAAAGATTGTCTGTAGCTTC

Hdysf30-F CACAGGCAGGCGGAGGCGGAGGGCG

Hex20-F CTCAGTACAGCCGTGCAGTCTT

Hex26-R TGTCCTTGGGTAGCTTGATCTTG

Hex31-R CGGACATGGAATCTTCACTCTTG

Hex21-F CCATAGAATCGAGACTCAGAACCAG

Hex24-R CCACAATTCTTGCCACAGTAGTTG

Hdysf41-F GGCTCTGCATGTGCTTCA

Hdysf56-R GACCTTGGAGATTGTAGCAGAG

Hdysf24-30-F CTTTCTGAAACACAGGCAGG

Hdysf31-R CTCAAGGTGGAGACGGACAT

bactin-F TGGCACCACACCTTCTACAATGAG

bactin-R CCGTGGTGGTGAAGCTGTAGCC

H-GAPDH-F GCACAAGAGGAAGAGAGAGACC

H-GAPDH-R GATGGTACATGACAAGGTGCGG



was performed only for full-length dysferlin and not trea-

ted; the same conditions were used as in the first-round

PCR except for the MgCl2 (1.5 mM) and the choice of the

primers: Hex21-F and Hex24-R (Table 1). All PCR prod-

ucts were analyzed on 2% agarose gels. Obtained bands

were acquired using the UVIsave Imaging System (UVItec

Ltd, Cambridge, UK). HEK cells were lysed directly in 19

sample buffer (1% SDS) with addition of commercially

available cocktails of protease and phosphatase inhibitors

(Complete and PhosSTOP; both from Roche, Mannheim,

Germany). Total protein concentration was determined

according to Lowry’s method. Samples were resolved on

12% polyacrylamide gel and transferred to supported nitro-

cellulose membranes (Bio-Rad Laboratories, Hercules, CA,

USA), and the filters were saturated in blocking solution

(10 mM Tris, pH 7.4, 154 mM NaCl, 1% BSA, 10% horse

serum, 0.075% Tween-20). Filters were incubated overnight

at 4 °C with anti-dysferlin IgG (1 : 200; Novocastra,

Newcastle, UK). Detection was performed with horseradish

peroxidase conjugated secondary antibodies (DakoCytoma-

tion, Carpinteria, CA, USA), followed by enhanced chemi-

luminescence development (Amersham Biosciences,

Piscataway, NJ, USA). Pre-stained molecular weight mark-

ers (Bio-Rad Laboratories, Hercules, CA, USA) were run

on each gel. Bands were visualized by autoradiography

using Amersham HyperfilmTM (Amersham Biosciences, Pis-

cataway, NJ, USA).

AON design and efficiency tests

Acceptor/donor splice sites and exon splicing enhancer

sequences located in exon 22 and 23 were used as targets for

AONs. Normal human cells were transfected with

Nucleofector� using 10 or 20 lg of AONs, individually or in

combinations. After 24–48 h, cells were harvested and RNA

was extracted. For each transfection condition, 1 lg RNA

was retrotranscribed, and 80 ng cDNA was used as the

matrix for the first PCR program. Primers were located in

exons 20 (fwd) and 26 (rev) in order to amplify shorter frag-

ments carrying an exon 22–23 deletion or larger ones, as

sometimes observed in previous studies [16,37]. A second

semi-nested PCR, using an internal forward primer located

in exon 21 and the same reverse primer (exon 26), was

performed using 2 lL of PCR product from the first PCR.

The skipping efficiency of the tested AONs was very low and

observed only with a high number of cycles in the nested

RT-PCR (70 cycles). For AON sequences, see Table 2.

Blood-derived CD133+ isolation

Blood CD133+ cells were collected from peripheral blood

of the two patients suffering from MM. CD133+ stem cells

were isolated as previously described [31]. After determin-

ing the purity of the CD133+ cells through cytofluorimetric

analysis, they were plated in a proliferation medium [55] at

a density of 15 9 104 cells�cm�2.

Lentivector carrying the full-length dysferlin

Considering the deep optimization needed to overcome

exon skipping difficulties, we developed a parallel strategy

based on complete dysferlin delivery by lentivirus vector.

We subcloned the complete dysferlin transcript into a lenti-

virus pRRL backbone (LV-DYSF) and tested its efficiency

in our two patients. Complete dysferlin cDNA was cut with

EcoRI and subcloned into pRRL-cPPT-hPGK-eGFP-

WPRE constructs [56]. Complete dysferlin was amplified

from plasmid pEGFP dysferlin, using the following

primers: DYSF-atg-NheI-Fw, 5′-ATTCGCTAGCATGCT

GAGGGTCTTCATCCTCT-3′, and DYSF-TGA-NheI-Rv,

5′-ATTCGCTAGCTCAGCTGAGGGCTTCACCAGC-3′.

The PCR product woas digested with NheI and subcloned

into pRRL-cPPT-hPGK-eGFP-WPRE vector. The trans-

duction efficiency of lentiviral vectors containing eGFP and

the dysferlin cassette was tested using the same multiplicity

of infection as previously described [40,41]. Both lentiviral

vectors showed the same transduction efficiency. To enlarge

the vector tropism, lentiviral vectors were pseudotyped with

the VSV-G virus and generated by transfection of the plas-

mid pCMVDR8.74 into 293T cells, as previously described

[57]. The infectious particle titer (ip�mL�1) was determined

by quantitative real-time PCR using genomic DNA of

transduced cells as described elsewhere [58]. Constructs

were sequenced on an ABI3130xl Genetic Analyzer

(Applied Biosystems, Carlsbad, CA, USA) and analyzed

with SEQUENCER software (Gene Codes Corporation, Ann

Arbor, MI, USA).

Lentiviral vector transduction

Dystrophic blood-derived CD133+ cells were transduced

using 107–108 ip�mL�1. In 96-well tissue culture dishes,

2–4 9 104 cells were plated per well; then we added 100 lLof DMEM supplemented with 10% fetal bovine serum.

Four hours post-transduction, 200 lL medium was also

added to each well. The dishes were incubated for 24 h at

37 °C and 5% CO2, followed by washing and in vitro stud-

ies or in vivo transplantation. The expression of full-length

Table 2. AON sequences

AON name 3′-sequence-5′ Targeted site, exon

HDysf22-1 AGCUUCCUGUGGAAUGGGCA 3′ (gt), ex22

HDysf22-2 GGUCCCCCCUACCUGCAGCCU 5′ (ag), ex22

HDysf23-1 AGAGGCUGGCUGUGAGGGAC 3′ (gt), ex23

HDysf23-2 ACGCAGACGCAGGAGCCAGU 5′ (ag), ex23

HDysf23-3 UUAAUUACCUCCUCUGCCAG 5′ (ag), ex23



dysferlin mRNA was demonstrated using RT-PCR analysis

as previously described. Primers (Hdysf41-F/Hdysf56-R)

are listed in Table 1.

Transplantation of the blood-derived CD133+cells into immunodeficient scid/blAJ mice

A breeding colony of homozygous scid/blAJ mice was pre-

viously established [33]. Their maintenance was authorized

by the National Institute of Health and Local Committee,

protocol number 10/10-2009/2010. All mice were fed ad lib-

itum and allowed continuous access to tap water. Five-

month-old scid/blAJ mice were deeply anesthetized with

2% avertin (0.015 mL�kg�1) prior to sacrifice by cervical

dislocation, and all efforts were made to minimize suffer-

ing. Human engineered CD133+ cells isolated from dystro-

phic blood (2 9 105 cells in 7 lL NaCl/Pi) were injected

into the right TA muscle of seven mice (six pre-treated with

ntx) as previously described [33]. One month after injection,

muscle tissues were removed, frozen in liquid nitrogen-

cooled isopentane and cryostat-sectioned.

Fluorescent in situ hybridization (FISH) and

immunofluorescence analyses on transplanted

muscles

Transplanted human cells were detected using a Texas Red-

labeled human a-centromeric probe. FISH analysis was

performed on frozen muscle sections. The slides were first

treated for 30 min with Histochoice Tissue Fixative

(Sigma-Aldrich, St. Louis, MO, USA) and sections were

dehydrated in 70%, 80% and 95% alcohol. The denatur-

ation was performed with 70% deionized formamide in 29

NaCl/Cit, and the slides were dehydrated again at �20 °C.The hybridization step was performed overnight at 37 °C.A Texas Red-labeled human a-centromeric (Exiqon A/S,

Vedbaek, Denmark) probe was used to identify human

cells. Nuclei were counterstained with 4′,6-diamidino-2-

phenylindole (DAPI). Non-transplanted human and mouse

muscle sections were used as positive and negative controls.

Slides were observed using a Leica TCS SP2 confocal

microscope (Leica, Hessen Wetzlar, Germany). A series of

10-lm transverse cryosections were cut over the injected

scid/blAJ muscle length and were examined by immunohis-

tochemical and hematoxylin and eosin staining. Dysferlin

positive myofibers were detected with monoclonal anti-dys-

ferlin IgG (NCL-DYSF; Novocastra) at a final dilution of

1 : 50, as previously described [33].

Nested RT-PCR and western blot for evaluation

of full-length dysferlin expression

To verify the in vivo expression of full-length dysferlin, a

series of 60 10-lm transverse cryosections from

throughout the injected muscle length were collected in

1.5-mL Eppendorf tubes and mixed with 800 lL TRIzol

reagent. cDNA was obtained as described above. To

detect human dysferlin mRNA, nested RT-PCR was

carried out with 1 lg cDNA using a final mix (Invitrogen

Life Technologies, Carlsbad, CA, USA) of 19 Taq buf-

fer, 1.5 mM MgCl2, 0.2 mM dNTP mix, 2.5 units Platinum

Taq DNA polymerase, 0.2 mM Hex20-F and 0.2 mM

Hex26-R. The program included 38 amplification cycles

of 94 °C for 2 min, 92 °C for 1 min, 52.8 °C for 2 min

and 72 °C for 2 min. PCR products were purified using

the Jetquick PCR Product Purification Spin Kit (Gen-

omed, Lohne, Germany) and a second round of amplifi-

cation was performed using 5 lL of purified PCR

product and the same conditions except for the MgCl2(1.5 mM) and the primers (Hex21-F and Hex24-R). PCR

conditions were as follows: 94 °C for 1 min, 65 °C for

1 min and 72 °C for 1 min (36 cycles). The PCR products

were analyzed on 2% agarose gel. For western blot

analysis, transplanted and non-transplanted muscles were

homogenized with an electric homogenizer using a 1%

Nonidet P-40 detergent buffer containing 20 mM Tris, pH

8, 137 mM NaCl, 2 mM EDTA, 10% glycerol and Com-

plete and PhosSTOP cocktails (Roche, Basel, Switzer-

land). Total protein concentration was determined

according to Lowry’s method. Samples were resolved on

12% polyacrylamide gel as previously described.

Membrane injury and membrane repair

monitoring

Human CD133+ cells were isolated from patients’ blood.

Before they were engineered with LV-FL DYSF, CD133+cells from both patients were pooled, as the patients’

mutations did not affect the expression of full-length dys-

trophin. We injected high numbers of cells in order to

obtain a higher number of transduced fibers, as LV-FL

DYSF could not be visualized. We transplanted

2 9 105 cells into the right TA muscle of five scid/blAJ

mice. Membrane repair assay after laser wounding was

conducted as previously described [7,59]. Briefly, single

muscle fibers (n = 100) were isolated from the TA,

1 month after the injection, by treatment with collagenase

I. Fibers were washed and resuspended in Dulbecco’s

NaCl/Pi containing 1 mM Ca2+ (Invitrogen Life Technol-

ogies, Grand Island, NY, USA). Single fibers were

mounted on a glass slide chamber, and membrane dam-

age was induced in the presence of FM 1-43 dye

(2.5 mM) (Invitrogen Life Technologies, Grand Island,

NY, USA) using a two-photon excitation technique with

a Chameleon Ultra II (Coherent, Santa Clara, CA, USA)

Ti : sapphire infrared laser source, directly coupled to the

scanning head of a Leica TCS SP5 confocal microscope.

To induce damage, a 5-lm2 area of the sarcolemma on

the surface of the muscle fiber was irradiated at full



power for 6.4 s at t = 20 s. Images were captured at 10-s

intervals, beginning 20 s before (t = 0) and for 3 min

after the irradiation. For every image taken, the fluores-

cence intensity at the site of the damage was measured

with IMAGEJ imaging software (De Novo Software, Los

Angeles, CA, USA).

Acknowledgements

This work was supported by the Association Mon�egas-

que contre les Myopathies (AMM), the Associazione

La Nostra Famiglia Fondo DMD Gli Amici di

Emanuele, the Associazione Amici del Centro Dino

Ferrari, EU’s Framework programme 7 Optistem

223098 and Provincia di Trento Fondo 12-03-5277500-

01. We thank Nicolas L�evy for technical assistance

and helpful discussion. No conflicts of interest exist.

References

1 Mansfield SG, Kole J, Puttaraju M, Yang CC, Garcia-

Blanco MA, Cohn JA & Mitchell LG (2000) Repair

of CFTR mRNA by spliceosome-mediated RNA

trans-splicing. Gene Ther 7, 1885–1895.

2 Emery AE (2002) The muscular dystrophies. Lancet

359, 687–695.

3 Bashir A, Liu YT, Raphael BJ, Carson D & Bafna V

(2007) Optimization of primer design for the detection

of variable genomic lesions in cancer. Bioinformatics 23,

2807–2815.

4 Liu X, Jiang Q, Mansfield SG, Puttaraju M, Zhang Y,

Zhou W, Cohn JA, Garcia-Blanco MA, Mitchell LG &

Engelhardt JF (2002) Partial correction of endogenous

DeltaF508 CFTR in human cystic fibrosis airway

epithelia by spliceosome-mediated RNA trans-splicing.

Nat Biotechnol 20, 47–52.

5 Nguyen K, Bassez G, Krahn M, Bernard R, Laforet P,

Labelle V, Urtizberea JA, Figarella-Branger D,

Romero N, Attarian S et al. (2007) Phenotypic study in

40 patients with dysferlin gene mutations: high

frequency of atypical phenotypes. Arch Neurol 64,

1176–1182.

6 Anderson LV, Davison K, Moss JA, Young C, Cullen

MJ, Walsh J, Johnson MA, Bashir R, Britton S, Keers

S et al. (1999) Dysferlin is a plasma membrane protein

and is expressed early in human development. Hum Mol

Genet 8, 855–861.

7 Bansal D, Miyake K, Vogel SS, Groh S, Chen CC,

Williamson R, McNeil PL & Campbell KP (2003)

Defective membrane repair in dysferlin-deficient

muscular dystrophy. Nature 423, 168–172.

8 de Luna N, Gallardo E, Soriano M, Dominguez-Perles

R, de la Torre C, Rojas-Garcia R, Garcia-Verdugo JM

& Illa I (2006) Absence of dysferlin alters myogenin

expression and delays human muscle differentiation

‘in vitro’. J Biol Chem 281, 17092–17098.

9 Roche JA, Lovering RM & Bloch RJ (2008) Impaired

recovery of dysferlin-null skeletal muscle after

contraction-induced injury in vivo. NeuroReport 19,

1579–1584.

10 Krahn M, Borges A, Navarro C, Schuit R, Stojkovic T,

Torrente Y, Wein N, Pecheux C & Levy N (2009)

Identification of different genomic deletions and one

duplication in the dysferlin gene using multiplex ligation-

dependent probe amplification and genomic quantitative

PCR. Genet Test Mol Biomarkers 13, 439–442.

11 Takahashi T, Aoki M, Tateyama M, Kondo E, Mizuno

T, Onodera Y, Takano R, Kawai H, Kamakura K,

Mochizuki H et al. (2003) Dysferlin mutations in

Japanese Miyoshi myopathy: relationship to phenotype.

Neurology 60, 1799–1804.

12 Lu QL, Morris GE, Wilton SD, Ly T, Artem’yeva OV,

Strong P & Partridge TA (2000) Massive idiosyncratic

exon skipping corrects the nonsense mutation in

dystrophic mouse muscle and produces functional

revertant fibers by clonal expansion. J Cell Biol 148,

985–996.

13 Aartsma-Rus A, Bremmer-Bout M, Janson AA, den

Dunnen JT, van Ommen GJ & van Deutekom JC

(2002) Targeted exon skipping as a potential gene

correction therapy for Duchenne muscular dystrophy.

Neuromuscul Disord 12 (Suppl 1), S71–77.

14 Goyenvalle A, Vulin A, Fougerousse F, Leturcq F,

Kaplan JC, Garcia L & Danos O (2004) Rescue of

dystrophic muscle through U7 snRNA-mediated exon

skipping. Science 306, 1796–1799.

15 Heemskerk HA, de Winter CL, de Kimpe SJ, van

Kuik-Romeijn P, Heuvelmans N, Platenburg GJ,

van Ommen GJ, van Deutekom JC & Aartsma-Rus

A (2009) In vivo comparison of 2′-O-methyl

phosphorothioate and morpholino antisense

oligonucleotides for Duchenne muscular dystrophy

exon skipping. J Gene Med 11, 257–266.

16 Aartsma-Rus A, Janson AA, Kaman WE, Bremmer-

Bout M, van Ommen GJ, den Dunnen JT & van

Deutekom JC (2004) Antisense-induced multiexon

skipping for Duchenne muscular dystrophy makes more

sense. Am J Hum Genet 74, 83–92.

17 Lu QL, Rabinowitz A, Chen YC, Yokota T, Yin H,

Alter J, Jadoon A, Bou-Gharios G & Partridge T

(2005) Systemic delivery of antisense

oligoribonucleotide restores dystrophin expression in

body-wide skeletal muscles. Proc Natl Acad Sci USA

102, 198–203.

18 Krahn M, Beroud C, Labelle V, Nguyen K, Bernard R,

Bassez G, Figarella-Branger D, Fernandez C, Bouvenot

J, Richard I et al. (2009) Analysis of the DYSF

mutational spectrum in a large cohort of patients. Hum

Mutat 30, E345–375.



19 Sinnreich M, Therrien C & Karpati G (2006) Lariat

branch point mutation in the dysferlin gene with mild

limb-girdle muscular dystrophy. Neurology 66,

1114–1116.

20 Wein N, Avril A, Bartoli M, Beley C, Chaouch S,

Laforet P, Behin A, Butler-Browne G, Mouly V, Krahn

M et al. (2010) Efficient bypass of mutations in

dysferlin deficient patient cells by antisense-induced

exon skipping. Hum Mutat 31, 136–142.

21 Gao G, Vandenberghe LH & Wilson JM (2005) New

recombinant serotypes of AAV vectors. Curr Gene Ther

5, 285–297.

22 Hermonat PL, Quirk JG, Bishop BM & Han L (1997)

The packaging capacity of adeno-associated virus

(AAV) and the potential for wild-type-plus AAV gene

therapy vectors. FEBS Lett 407, 78–84.

23 Duan D, Yue Y, Yan Z & Engelhardt JF (2000) A new

dual-vector approach to enhance recombinant adeno-

associated virus-mediated gene expression through

intermolecular cis activation. Nat Med 6, 595–598.

24 Harper SQ, Hauser MA, DelloRusso C, Duan D,

Crawford RW, Phelps SF, Harper HA, Robinson AS,

Engelhardt JF, Brooks SV et al. (2002) Modular

flexibility of dystrophin: implications for gene therapy

of Duchenne muscular dystrophy. Nat Med 8, 253–261.

25 Krahn M, Wein N, Bartoli M, Lostal W, Courrier S,

Bourg-Alibert N, Nguyen K, Vial C, Streichenberger N,

Labelle V et al. (2010) A naturally occurring human

minidysferlin protein repairs sarcolemmal lesions in a

mouse model of dysferlinopathy. Sci Transl Med 2,

50ra69.

26 Lostal W, Bartoli M, Bourg N, Roudaut C, Bentaib A,

Miyake K, Guerchet N, Fougerousse F, McNeil P &

Richard I (2010) Efficient recovery of dysferlin

deficiency by dual adeno-associated vector-mediated

gene transfer. Hum Mol Genet 19, 1897–1907.

27 Grose WE, Clark KR, Griffin D, Malik V, Shontz

KM, Montgomery CL, Lewis S, Brown RH Jr, Janssen

PM, Mendell JR et al. (2012) Homologous

recombination mediates functional recovery of dysferlin

deficiency following AAV5 gene transfer. PLoS One 7,

e39233.

28 Endo T (2007) Stem cells and plasticity of skeletal

muscle cell differentiation: potential application to cell

therapy for degenerative muscular diseases. Regen Med

2, 243–256.

29 Nowak KJ & Davies KE (2004) Duchenne muscular

dystrophy and dystrophin: pathogenesis and

opportunities for treatment. EMBO Rep 5, 872–876.

30 Singh N, Pillay V & Choonara YE (2007) Advances in

the treatment of Parkinson’s disease. Prog Neurobiol 81,

29–44.

31 Torrente Y, Belicchi M, Sampaolesi M, Pisati F,

Meregalli M, D’Antona G, Tonlorenzi R, Porretti L,

Gavina M, Mamchaoui K et al. (2004) Human

circulating AC133(+) stem cells restore dystrophin

expression and ameliorate function in dystrophic

skeletal muscle. J Clin Invest 114, 182–195.

32 Benchaouir R, Meregalli M, Farini A, D’Antona G,

Belicchi M, Goyenvalle A, Battistelli M, Bresolin N,

Bottinelli R, Garcia L et al. (2007) Restoration of

human dystrophin following transplantation of exon-

skipping-engineered DMD patient stem cells into

dystrophic mice. Cell Stem Cell 1, 646–657.

33 Farini A, Sitzia C, Navarro C, D’Antona G, Belicchi

M, Parolini D, Del Fraro G, Razini P, Bottinelli R,

Meregalli M et al. (2012) Absence of T and B

lymphocytes modulates dystrophic features in dysferlin

deficient animal model. Exp Cell Res 318, 1160–1174.

34 Cartegni L & Krainer AR (2003) Correction of disease-

associated exon skipping by synthetic exon-specific

activators. Nat Struct Biol 10, 120–125.

35 Desmet FO, Hamroun D, Lalande M, Collod-Beroud

G, Claustres M & Beroud C (2009) Human Splicing

Finder: an online bioinformatics tool to predict splicing

signals. Nucleic Acids Res 37, e67.

36 Aartsma-Rus A, Kaman WE, Bremmer-Bout M,

Janson AA, den Dunnen JT, van Ommen GJ & van

Deutekom JC (2004) Comparative analysis of antisense

oligonucleotide analogs for targeted DMD exon 46

skipping in muscle cells. Gene Ther 11, 1391–1398.

37 Ittig D, Liu S, Renneberg D, Schumperli D &

Leumann CJ (2004) Nuclear antisense effects in

cyclophilin A pre-mRNA splicing by oligonucleotides:

a comparison of tricyclo-DNA with LNA. Nucleic

Acids Res 32, 346–353.

38 Follenzi A, Ailles LE, Bakovic S, Geuna M & Naldini

L (2000) Gene transfer by lentiviral vectors is limited

by nuclear translocation and rescued by HIV-1 pol

sequences. Nat Genet 25, 217–222.

39 Mortellaro A, Hernandez RJ, Guerrini MM, Carlucci

F, Tabucchi A, Ponzoni M, Sanvito F, Doglioni C,

Di Serio C, Biasco L et al. (2006) Ex vivo gene therapy

with lentiviral vectors rescues adenosine deaminase

(ADA)-deficient mice and corrects their immune and

metabolic defects. Blood 108, 2979–2988.

40 Li S, Kimura E, Fall BM, Reyes M, Angello JC,

Welikson R, Hauschka SD & Chamberlain JS (2005)

Stable transduction of myogenic cells with lentiviral

vectors expressing a minidystrophin. Gene Ther 12,

1099–1108.

41 Quenneville SP, Chapdelaine P, Skuk D, Paradis M,

Goulet M, Rousseau J, Xiao X, Garcia L & Tremblay

JP (2007) Autologous transplantation of muscle

precursor cells modified with a lentivirus for muscular

dystrophy: human cells and primate models. Mol Ther

15, 431–438.

42 Ho M, Post CM, Donahue LR, Lidov HG, Bronson

RT, Goolsby H, Watkins SC, Cox GA & Brown RH Jr

(2004) Disruption of muscle membrane and phenotype



divergence in two novel mouse models of dysferlin

deficiency. Hum Mol Genet 13, 1999–2010.

43 Bashir R, Britton S, Strachan T, Keers S, Vafiadaki E,

Lako M, Richard I, Marchand S, Bourg N, Argov Z

et al. (1998) A gene related to Caenorhabditis elegans

spermatogenesis factor fer-1 is mutated in limb-girdle

muscular dystrophy type 2B. Nat Genet 20, 37–42.

44 Liu J, Aoki M, Illa I, Wu C, Fardeau M, Angelini C,

Serrano C, Urtizberea JA, Hentati F, Hamida MB

et al. (1998) Dysferlin, a novel skeletal muscle gene, is

mutated in Miyoshi myopathy and limb girdle muscular

dystrophy. Nat Genet 20, 31–36.

45 Surono A, Van Khanh T, Takeshima Y, Wada H,

Yagi M, Takagi M, Koizumi M & Matsuo M (2004)

Chimeric RNA/ethylene-bridged nucleic acids promote

dystrophin expression in myocytes of Duchenne

muscular dystrophy by inducing skipping of the

nonsense mutation-encoding exon. Hum Gene Ther 15,

749–757.

46 De Luna N, Freixas A, Gallano P, Caselles L, Rojas-

Garcia R, Paradas C, Nogales G, Dominguez-Perles R,

Gonzalez-Quereda L, Vilchez JJ et al. (2007) Dysferlin

expression in monocytes: a source of mRNA for

mutation analysis. Neuromuscul Disord 17, 69–76.

47 Therrien C, Dodig D, Karpati G & Sinnreich M (2006)

Mutation impact on dysferlin inferred from database

analysis and computer-based structural predictions.

J Neurol Sci 250, 71–78.

48 Millay DP, Maillet M, Roche JA, Sargent MA,

McNally EM, Bloch RJ & Molkentin JD (2009)

Genetic manipulation of dysferlin expression in skeletal

muscle: novel insights into muscular dystrophy. Am

J Pathol 175, 1817–1823.

49 Lostal W, Bartoli M, Roudaut C, Bourg N, Krahn M,

Pryadkina M, Borel P, Suel L, Roche JA, Stockholm D

et al. (2012) Lack of correlation between outcomes of

membrane repair assay and correction of dystrophic

changes in experimental therapeutic strategy in

dysferlinopathy. PLoS One 7, e38036.

50 Dellavalle A, Sampaolesi M, Tonlorenzi R, Tagliafico

E, Sacchetti B, Perani L, Innocenzi A, Galvez BG,

Messina G, Morosetti R et al. (2007) Pericytes of

human skeletal muscle are myogenic precursors distinct

from satellite cells. Nat Cell Biol 9, 255–267.

51 Gavina M, Belicchi M & Camirand G (2006) VCAM-1

expression on dystrophic muscle vessels has a critical

role in the recruitment of human blood-derived

CD133+ stem cells after intra-arterial transplantation.

Blood 108, 2857–2866.

52 Sampaolesi M, Torrente Y, Innocenzi A, Tonlorenzi R,

D’Antona G, Pellegrino MA, Barresi R, Bresolin N,

De Angelis MG, Campbell KP et al. (2003) Cell

therapy of alpha-sarcoglycan null dystrophic mice

through intra-arterial delivery of mesoangioblasts.

Science 301, 487–492.

53 Gupta RC, Earley K & Sharma S (1988) Use of human

peripheral blood lymphocytes to measure DNA binding

capacity of chemical carcinogens. Proc Natl Acad Sci

USA 85, 3513–3517.

54 Klinge L, Laval S, Keers S, Haldane F, Straub V,

Barresi R & Bushby K (2007) From T-tubule to

sarcolemma: damage-induced dysferlin translocation in

early myogenesis. FASEB J 21, 1768–1776.

55 Summan M, Warren GL, Mercer RR, Chapman R,

Hulderman T, Van Rooijen N & Simeonova PP (2006)

Macrophages and skeletal muscle regeneration: a

clodronate-containing liposome depletion study. Am

J Physiol Regul Integr Comp Physiol 290, R1488–R1495.

56 Dull T, Zufferey R, Kelly M, Mandel RJ, Nguyen M,

Trono D & Naldini L (1998) A third-generation

lentivirus vector with a conditional packaging system.

J Virol 72, 8463–8471.

57 Zufferey R, Nagy D, Mandel RJ, Naldini L & Trono

D (1997) Multiply attenuated lentiviral vector achieves

efficient gene delivery in vivo. Nat Biotechnol 15,

871–875.

58 Charrier S, Stockholm D, Seye K, Opolon P, Taveau

M, Gross DA, Bucher-Laurent S, Delenda C,

Vainchenker W, Danos O et al. (2005) A lentiviral

vector encoding the human Wiskott–Aldrich

syndrome protein corrects immune and cytoskeletal

defects in WASP knockout mice. Gene Ther 12,

597–606.

59 Diaz-Manera J, Touvier T, Dellavalle A, Tonlorenzi R,

Tedesco FS, Messina G, Meregalli M, Navarro C,

Perani L, Bonfanti C et al. (2010) Partial dysferlin

reconstitution by adult murine mesoangioblasts is

sufficient for full functional recovery in a murine model

of dysferlinopathy. Cell Death Dis 1, e61.



Full-length dysferlin expression driven by engineered human dystrophic blood derived CD133+ stem...

Documents

Transcript of Full-length dysferlin expression driven by engineered human dystrophic blood derived CD133+ stem...