Collana dei rapporti tecnici annuali dell'Istituto di ... Tecnico_Volume 1.pdf · ISSN: 2531-3878...

ISSN: 2531-3878

Collana dei rapporti tecnici annuali

dell'Istituto di Bioimmagini e Fisiologia

Molecolare (IBFM) -CNR

Radiobiological investigations in breast cancer cells

Numero 1, Dicembre 2015

Rapporto Tecnico, numero 1, Dicembre 2015 IBFM

1

Rapporto Tecnico CNR - IBFM

Anno 1, Numero 1, Dicembre 2015

Editore e Direttore Responsabile

Prof.ssa Maria Carla Gilardi

Direzione e Redazione

IBFM - CNR

Istituto di Bioimmagini e Fisiologia Molecolare - CNR

Edificio LITA - Via F.lli Cervi, 93 - 20090 Segrate (MI), Italy

Tel. 0221717514

Fax 0221717558

www.ibfm.cnr.it

U.O.S. Cefalù

c/o Fondazione Istituto S. Raffaele- G.Giglio

Contrada Pietrapollastra-Pisciotto

90015 Cefalù (PA)

[email protected]

U.O.S. Genova

c/o DINOGMI

Via De Toni, 5

16132 Genova

[email protected]

U.O.S. Germaneto

Campus Universitario V.le Europa

88100 Germaneto (CZ)

[email protected]

Copyright Dicembre 2015 by IBFM - CNR

ISSN: 2531-3878


2

Preface

The research activities of the Laboratory of Genomic and Cellular Methodologies of the Institute of

Molecular Bioimaging and Physiology (IBFM)-CNR Cefalù Research section, aim at improving the

diagnosis and treatment of oncological and age-related diseases, through the study of molecular

mechanisms of a pathological process, in order to identify new biomarkers and novel therapeutic

personalized approaches. The Laboratory takes advantage from expertise in genetics, genomics,

proteomics, cell cultures and Animal Science. Main research lines are related to the radiobiology

field using ionizing radiation (IR) and the therapeutic use of ultrasound, employing in vitro, ex-

vivo, and in-vivo preclinical techniques.

In the context of cancer treatment, radiotherapy (RT) plays an important role, as more than 50% of

cancer patients receive RT as part of multimodal treatment of their disease. RT can be delivered

percutaneously, interventionally e.g., as brachytherapy or during surgery as IntraOperative

RadioTherapy (IORT). IORT is increasingly used for different entities as it delivers targeted RT to

the tumor bed immediately during surgery. It is a therapeutic technique which consists of

administering a single high dose of IR immediately after surgical removal of tumor to destroy the

residual cancer cells that may be left in the tumor site. The most experience in IORT is reported for

breast cancer (BC). IntraOperative Electron Radiation Therapy (IOERT), using an electron linear

accelerator, according to specific eligibility criteria, may be: exclusive with the provision of a single

radiation dose of 21-23 Gy corresponding to the administration of the entire sequence of a

conventional adjuvant RT, or based an anticipated boost of 9-12 Gy, followed by conventional

external RT to guarantee for optimal accuracy in dose delivery. Although preliminary results of

partial breast irradiation with IOERT, either as an anticipated boost or as exclusive treatment, seem

be promising in terms of local disease control, little information has been collected about the

biological basis of the effects of IOERT, in particular those regarding molecular stress mechanisms

and pathways involved in cellular response. Despite the great interest of the scientific community

regarding the clinical application of IR to various cancer types, a limited number of studies describe

the molecular basis of IOERT effects. In particular, gene-expression profiles of BC cells treated

with high IR doses, such as those delivered during IOERT, need to be explored

The use of focused ultrasound for therapeutic purposes has been known since the beginning of this

century, but only in the last two decades it has been observed a concrete development of advanced

imaging techniques that made their clinical use possible, such as the high intensity focused

ultrasounds (HIFU) systems in combination with diagnostic ultrasounds (USgFUS) or magnetic

resonance imaging (MRgFUS). To date, although the FDA-approved clinical applications are still

limited to a few areas, such as the ablation of uterine fibroids and prostatic cancer plus the bone


3

metastases pain palliative treatment, a great ferment in the scientific research is related to the

optimization of protocols and methods to maximize the use of this technology in the field of solid

tumours ablation and the treatments of neurodegenerative diseases, pain and vascular problems.

Furthermore, since the modulation of physical parameters generates a multiplicity of thermal and

non-thermal effects having disparate biological implications, multiple areas of researches are on-

going worldwide on drug delivery, blood barrier opening, hyperthermia and cell sensitization to

radiation treatments. In this sense, the beam intensity modulating renders the use of US an adjuvant

therapy in combination to traditional surgery, radiation or chemotherapy treatments.

In this Technical Report we provide some insights to the field of the biological effects induced by

IR and by the therapeutic use of ultrasound, employing in vitro approaches. By reporting our

experience and describing in details the experimental methods adopted and the main results

obtained, in particular to the treatment of BC cells, we aim at supporting other researchers in

defining good experimental designs and analysis methods to study the molecular and cellular

mechanisms induced by different treatment modalities such as IOERT and MRgFUS.


4

Index

-Analysis of the molecular response to ionizing radiation treatments by

OMICs approach.................................................................................................

Pag 5

-Experimental approach to study the inflammatory breast response to

radiation................................................................................................................

Pag 21

-Breast cancer cell response to electron beam

irradiation..............................................................................................................

Pag 38

-Experimental assessment of the accuracy of genomic response to radiation

treatment in cancer cells.......................................................................................

Pag 47

-Technical evaluation of the morphology and survival rates of cells exposed

to ionizing radiation..............................................................................................

Pag 61

-Transcriptional changes radiation-induced in mammary

cells..........................................................................................................................

Pag 70

-A quality assurance setup for ultrasounds in vitro

experiments.............................................................................................................

Pag 81

-Technical analysis of cell growth and viability induced by ultrasounds in-

vitro treatments: a preliminary approach...........................................................

Pag 94


5

Analysis of the molecular response to ionizing radiation treatments by OMICs approach

Luigi Minafra1*, Valentina Bravatà1, Francesco P Cammarata1, Cristina Messa1,2,3, Maria C

Gilardi1,3,4 and Giusi I Forte1

1Institute of Bioimaging and Molecular Physiology, National Research Council (IBFM-CNR) -LATO,

Cefalu (PA), Italy; 2Nuclear Medicine Center, San Gerardo Hospital, Monza, Italy; 3Department of Health Sciences, Tecnomed Foundation, University of Milano-Bicocca, Milan, Italy; 4Nuclear Medicine, San Raffaele Scientific Institute, Milan, Italy.

Abstract

Ionizing radiations (IR) generated for the radiation therapy (RT) treatments

activate both pro- and antiproliferative signal pathways producing an

imbalance in cell fate decision regulated by several genes and factors

involved in cell cycle progression, survival and/or cell death, DNA repair

and inflammation. Here we describe the latest advances on molecular

response to IR, reporting the most relevant data from cell biology, gene

expression profiling, proteomic and epigenetic researches on different cell

types. Understanding the cell molecular strategies to choose between death

or survival, after an irradiation-induced damage, opens new avenues for the

selection of a proper therapy schedule, to counteract cancer growth and

preserve healthy surrounding tissue by radiation effects.

* Corresponding author: [email protected]


6

Introduction

The radiosensitivity and radioresistance of tumors and healthy tissue is the major clinical issue

object of research in radiobiology. The aim of radiotherapy (RT) is to achieve local tumour control,

to kill selectively the cancer cells without causing significant damage to the surrounding normal

tissues. Ionizing radiation (IR) is both a carcinogen and a therapeutic agent: exposure at low doses,

for example, can increase an individual risk of developing cancer, while sufficient high doses can

slow down or stop even tumor growth. RT uses high energy IR, such as X-rays, γ-rays, charged

particles, e.g electrons with high dose rate, protons and heavy ions (1-2).

IR induces direct or indirect damage to principal biological molecules according to its linear energy

transfer (LET). When the radiation has a high LET, cell damages are mainly induced by direct

ionization of macromolecules including DNA, RNA, lipids, and proteins. On the other hand, low

LET radiations cause indirect damage to macromolecules, due to the generation of reactive oxygen

species (ROS), especially superoxide and hydroxide radicals from the radiolysis of intracellular

H2O, and reactive nitric oxide species (RNOS), which can both oxidate macromolecules and

activate several intracellular signaling pathways, leading to stress responses and inflammation (2-4).

Lesions involving DNA may be nitrogenous bases alterations, breaks in one (SSBs) or both DNA

(DSBs) chains and chains cross-linking after breakage. Unrepaired DNA damage, due to IR can

lead to mutations, genomic instability and cell death. Generally, DSBs have more lethal effects on

cells than SSBs, even when induced by low LET radiation (5-6). In addition, although it is

commonly recognized that the DNA is the principal radiation molecular target, it has recently been

demostrated that proteins are also important IR targets that may trigger cell death mechanisms.

Radiation-induced death by protein damage is thought to be caused by reduced DNA repair fidelity,

indirectly reducing cell viability. There is evidence that proteins are major initial targets of free

radicals and in vitro studies on cultured mammalian cell lines showed that protein oxidation may

activate pro-apoptotic signaling pathways downstream of IR induced damage (7). In general, both

DNA and protein damages contribute to the overall effect of IR toxicity, even if, which of them

primarily influences cell death, has not yet been defined.

IR activates both pro- and antiproliferative signal pathways producing an imbalance in

survival/apoptosis cell decision (2,6), regulated by several genes and factors involved in cell cycle

progression, survival and/or cell death, DNA repair and inflammation. However, the contribution of

these genes and signaling pathways, especially those controlling different cellular death

mechanisms, need to be further investigated. Moreover, the cellular response to ionizing radiation is

highly complex, heterogeneous and highly dependent on cell type.


7

We report the latest advances on molecular response to IR, describing the most relevant data from

proteogenomic recent studies, regarding different tumor cell types including breast cancer (BC).

The possibility to clarify cell molecular strategies to choose between death or survival, after an

irradiation-induced damage, opens new avenues for the selection of a proper therapy schedule, to

counteract cancer growth and preserve healthy surrounding tissue from radiation effects.

DNA repair mechanisms

The biological effects of irradiation are dependent by several pathways controlling response to

DNA damage, such as the DNA damage response (DDR). The DNA repair mechanisms are crucial

in the cell fate decision after irradiation. Cells have evolved complex systems to rapidly detect and

efficiently repair DNA lesions, both the SSBs and DSBs (8-9). It has been observed that

approximately 40 DSBs are induced for each dose delivered (1-2 Gy for most cells) and that non-

transformed or non-immortalized cells, i.e. normal cells, can repair about 70 DSB/cell within 24

hours (hrs) following the radiation exposure (6).

Two main pathways are known for repairing DSBs: the non homologous end joining (NHEJ) and

the homologous recombination (HR), that are complementary and used in different cell cycle phases

(9-10). During cell cycle, these DNA repair mechanisms may be differentially activated. The NHEJ

drived mechanism is thought to be active during G1/G0 cell cycle phases. Ku heterodimer is

required as sensor to start NHEJ. It is formed by the Ku70 and Ku80 subunits, that recognize and

bind to the DSB. In proliferating cells, DSB can be repaired through a HR-dependent mechanism

during the middle and late S-phase and the G2/M checkpoint requiring a homologous template. The

MRN complex, formed by Mre11, Rad50 and NBN proteins, represents the DNA damages sensor,

which controls the responses to DSBs via HR mechanisms. Instead, DNA repair is inefficient

during the S phase. Another factor that plays important roles in the cellular response to DNA

damage is ATM (Ataxia Telangiectasia Mutated Protein). It belongs to the family of

phosphatidylinositol 39-kinase-like kinase (PIKK), serine/threonine protein kinases which also

includes two others members, ATR (Ataxia Telangiectasia and Rad3 related) and DNA dependent

protein kinase (DNA-PK) (10-12).

Chromatin structure is involved early, after IR injury, in particular the ATM/ATR/DNA-PK

complex causes rapid phosphorylation of the histone H2AX on chromatin alongside DSBs, over

some megabase of DNA regions flanking the breaks. The resulting phosphorylated H2AX (γH2AX)

sites can be detected during the interphase, preferentially in euchromatic regions, by using

immunofluorescence microscopy, already three minutes after IR exposure. These sites, named

γH2AX foci, are also known as IRIF (Ionizing Radiation Induced Foci) (12-14). Afterwards


8

γH2AX foci are formed as a platform for the recruitment or retention of other DNA repair and

signaling molecules, the DNA repair processes can go beyond. ATM also phosphorylates p53, “the

genome guardian”, which exerts a crucial role following IR-induced DNA damage. In addition,

p53-binding protein 1 (53BP1) is a DNA damage response factor, classified as an adaptor/mediator

required for the processing of DNA damage response signal, early recruited to damage sites and

readily contributing to γH2AX foci formation. ATR is also recruited to DSBs sites and promotes

cell cycle block through Chk proteins activation (15-16). The signaling via ATM/ATR can induce

apoptosis or cell senescence when DNA lesions are unrepairable DSBs (8,11,17).

Two other important factors responsible of genomic stability maintenance, supporting efficient and

precise DSB repair, are the BRCA1 and BRCA2 proteins (18). In particular, after IR exposure,

BRCA1 is activated through phosphorylation by ATM and Chk2 and regulates cell-cycle arrest both

during the G1-S and the G2-M checkpoints. In addition, BRCA1 has been associated with several

proteins involved in the response to DNA damage and in the repair mechanism. The BRCA2 main

role is to control the RAD51-mediated recombination during DSB repair by HR. The BRCA2

activity is controlled by CDKs (cyclin-dependent-kinases) in a cell cycle-dependent manner: low

levels of BRCA2 phosphorylation in S phase reduce its action, while increased phosphorylation

levels during G2-M progression favor the interaction with RAD51 and, therefore, the HR-mediated

DNA repair mechanism (6,18-19).

Different radiation-induced cell death mechanisms

The aim of RT is to deprive cancer cells of their reproductive potential, inducing cell death to

remove any remaining potential cancer cells. Several pathways are today known that can affect cell

death after irradiation, so cell death remains very difficult to be tested. Nowadays, accumulating

evidence reveals that induction of cell death is a very complex mechanism to account for the

different therapeutic effects of IR. Indeed, in the last years it is becoming clearer that the inhibition

of neoplastic cells proliferative capacity following irradiation, in particular for solid tumors, can

occur through different types of cell death such as: apoptosis, necrosis, mitotic catastrophe (MC),

autophagy and senescence. In general, cells do not die immediately after IR treatment, but death

arises after replications, frequently after 3-4 cell divisions (6,17,20).

Many factors, including radiation type and dose intensity, cell type, cell cycle phase, oxygen

tension, DNA repair ability, genetic variations such as SNPs (Single Nucleotide Polymorphisms)

sited on genes involved in radiosensitivity and /or radiotherapy toxicity, can define the type of cell

death after irradiation (17,21).


9

Apoptosis. Apoptosis or programed cell death, is a highly regulated mechanism of cell death.

Distinct cytoplasmic and nuclear morphologic changes are recognizable in cells undergoing

apoptosis, such as cell shrinkage, contraction and membrane blebbing, nuclear condensation, DNA

fragmentation and cell destruction into membrane-bound particles. The apoptotic mechanism

involves a complex network of factors according to the origin of death signal. Two principal

apoptotic pathways are the well known intrinsic and extrinsic apoptosis. The intrinsic pathway is

triggered by internal cell signaling, regulating mitochondrial integrity, the mitochondrial

Cytochrome C release and the consequent apoptosome complex formation, composed by Apaf1

(Apoptotic protease activating factor 1) and procaspase-9. The extrinsic pathway is induced by

extracellular signals transduced by the so-called transmembrane “Death Receptors” (DR, e.g., Fas

with Fas Ligand), which belong to the tumor necrosis factor (TNF) receptor superfamily. Both

apoptotic pathways control the activation of specific caspases, a family of cysteine-aspartic

proteases involved in the apoptotic cell death mechanism. These apoptotic pathways may converge

inducting the activator caspases (e.g., caspase-3, -6, -7 and -8), required for target degradation via

protein lysis and DNA fragmentation (22-24). In IR exposed cancer cells, both intrinsic and

extrinsic apoptotic pathways may occur, according to delivered doses and cell type. DNA IR-

induced SSBs and DSBs primarily trigger apoptosis by intrinsic pathway, when DNA lesions are

unrepairable and generally via ATM/ATR signaling. Apoptotic pathways can be p53-dependent,

following activation by ATM, to avoid the p53 ubiquitination by MDM2 and consequent

proteosomal degradation. IR-induced p53, causes a downtream activation of the death factors, such

as Fas, Fas Ligand (23-25). The p53 expression level and mutational status exert an important role

in the cell decision to undergo death through apoptosis after irradiation. It has been observed that

the tissues more sensitive to radiation-induced apoptosis, such as the spleen, the thymus and the

testis, show higher levels of p53 in respect of the liver and the kidney radioresistant tissues. Tumors

that result responsive to p53-dependent apoptosis are generally radiosensitive, whereas tumors that

overexpress antiapoptotic proteins such as BCL2, Bcl-XL and Survivin, or do not express pro-

apoptotic crucial proteins, including p53, are more radioresistant (25-26). In general, different types

of cancer cells, such as lung, prostate, colon cancer and immortalized keratinocytes, undergo

apoptosis upon IR exposure from 1 to 20 Gy. Some non-immortalized cells show apoptotic

responses only when treated with higher doses of IR (>20 Gy) (6,26).

Necrosis. Necrosis has generally been considered as a tumor cell death process that predominates

after a high IR dose treatment, while at a lower dose it has been indicated as a passive and

unregulated event. High radiation exposures, ranging from 32 to 50 Gy, for example, were able to

induce necrosis in in vitro cultured neurons and in p53-deficient human leukemia cells. In contrast,


10

lower IR doses, in particular 0.5 Gy of γ- rays, induced necrosis in the immortalized human

keratinocyte cell line HaCaT. Recent studies show that IR can induce regulated cell death by

necrosis in some types of tumor such as endocrine cancers, a mechanism defined as programed

necrosis or necroptosis. Some components of the DR signaling system, such as the adaptor protein

FADD (Fas-associated death domain) are common in both necrosis and apoptosis, but the final

choice between these mechanisms seems to depend on caspase-8 and RIP1 (receptor interacting

protein 1) activities. Necrotic cells display some typical morphological characteristics, such as

plasma membranes permeabilization with consequent loss of intracellular contents, organelle

swelling, mitochondrial dysfunction, but unlike apoptotic, necrotic cells generally do not show any

signs of DNA fragmentation. In contrast to apoptosis, radiation-induced necrosis is often associated

with increased inflammation of the surrounding normal tissue [6,25, 27-28].

Senescence. In normal epithelial cells, senescence is a known strategy during aging and an increase

of senescent cells in older tissues or in IR treated tissues may be responsible for some pathology

onsets. Several stress stimuli, in addition to IR-induced DNA damage, can trigger senescence, such

as oxidative stress, chemotherapeutic agents and extended signaling by some cytokines, including

interferon-α (INF-α) and transforming growth factor-β (TGF-β). Different gene expression

alterations, such as deregulated expression of cell cycle regulatory proteins, which induce cell cycle

arrest, upregulation of anti-apoptotic factors, high expression levels of inflammatory cytokines,

growth factors and proteases, have been observed in senescent cells. These characteristics are

defined as senescence associated secretory phenotype (SASP) (29). When grown in culture,

senescent cells display a specific and typical morphology with plasma membrane and nucleus

macroscopic alterations, cytoskeletal organization, changes in cell-cell interactions showing the so-

called “fried egg” like appearance. A well recognized senescence marker is the senescence-

associated β-galactosidase (SA-β-gal), whose increased expression has been correlated with

senescence in many cell types. The DNA damage-induced signaling pathways which trigger

senescence associated cell cycle arrest are mainly regulated by p53/p21(waf1, CDKN1A), by p16

(INK4a, CDKN2A) and Rb (retinoblastoma) factors. IR may induce accelerated cellular

senescence, a state of irreversibile growth arrest in which the damaged cells show altered functions

and, despite being vital, are no longer competent for proliferation. It has been demostrated that

senescence is the principal response of some cell types at IR lower doses, whereas higher doses are

required for the induction of apoptosis or necrosis in the same cells (29-31). Actually, most

radiobiologic research papers demonstrate that there is not a unique and absolute kind of response

for all cell types to a certain IR dose. Today the aspects establishing the specific cellular fate after


11

IR exposure have not been clearly defined, but increasing evidence suggests that the type and

radiation doses are primarly important, as well as different cell features (6,21).

Autophagy. Autophagy is a basic catabolic mechanism that involves cell degradation of unnecessary

or dysfunctional cell components, such as damaged ER (endoplasmic reticulum) and other

cytoplasmic constituents through lysosomes action. In the context of a disease, autophagy has been

described as an adaptive response to survival, whereas in other cases it appears to promote

programed cell death, via non-apoptotic and caspase-independent mechanism. However, there is

significant evidence that reveals a cross-talk between autophagy and apoptosis (32-33). In tumor

cells undergoing chronic hypoxia and nutrient depletion, autophagy is a strategy to maintain

metabolic homeostasis. After stress stimuli, such as nutrient starvation, protein aggregation,

organelle damage, oxidative or genotoxic stress, including IR, the autophagy hyper-activation

promotes cell death and this case is also called macroautophagy (34-35). A tipical cell trait of

autophagy is the phagophore, the site of membrane production generated when this process starts.

Autophagic pathways can induce survival or cell death following IR treatment, processes that might

be cell and tissue specific and dependent on the expression of genes and proteins controlling

apoptosis (33-35). In the literature there is conflict with respect to the IR-triggered autophagic

effect, resulting in survival or cell death promotion. Some studies show that, the autophagy

preventing is radiosensitive, while the autophagy promoting is radioprotective, suggesting that IR-

induced autophagy may represent an adaptive response to maintain tumor growth and survival. For

example, in radioresistant BC cells a strong post-irradiation autophagy induction has been observed

as a protective and pro-survival mechanism of radioresistance after exposure to IR of 4-5 Gy (6,34).

In contrast with these data, other studies show that induced autophagy in some radioresistent cancer

cells, including glioblastoma and lung cells, causes IR sensitization increasing cell death (6,25). The

molecular machinery involved in IR-induced autophagy is still not clear. IR-induced DNA damage

seems to be the initiating event that causes autophagy. Recent studies show that p53 and PARP-1, a

DNA repair enzyme triggered by DNA damage, exert essential roles in starting the autophagy

process regulating the PI3K/PKB/AKT/mTOR signaling pathway that represents an autophagy key

regulator (6,25, 35)

Mitotic catastrophe. Mitotic catastrophe (MC) has initially been described as a cell death

mechanism, occurring during or after aberrant mitosis, associated with various morphological and

biochemical changes following radiation-induced incomplete DNA synthesis. Several evidence has

revealed that it can also be caused by chemical or physical stresses and represents an

oncosuppressive mechanism to avoid genomic instability. MC has been defined as a special

example of apoptosis because it shows several biochemical apoptosis features, including


12

mitochondrial membrane permeabilization and caspase activation. However, it has been observed

that MC may result in death that requires both caspase-dependent or caspase-independent

mechanisms. Tumor cells, harboring checkpoint deficiencies that cause incomplete DNA repair,

replicative infidelity or aberrant chromosome segregation, may undergo to MC. Thus, the IR-

induced loss of checkpoint controls in treated cancer cells may lead to the generation of aneuploid

progeny and MC associated cell death. In IR-treated tumor cells, MC is often associated with

delayed apoptosis following increased expression of some receptors and their ligands, such as Fas,

TRAIL, TNF. Moreover, caspase-2 represents the initiator caspase induced during delayed

apoptosis after MC (25,35-39).

OMIC profiles radiation-induced

It is now well accepted by the scientific community that to study the biological effects of IR is

essential an OMIC approach to take into account both the complexity of the different cell types

involved and several types of particles and doses delivered. Experimental data from proteomics,

genomics and transcriptomics, termed all together “Proteogenomics”, are emerging as a

fundamental step to analyze globally and simultaneously DNA, RNA, protein expression and

epigenetic modifications in order to highlight molecular mechanisms underlying cellular processes

and biological events induced by several type of stress such as IR. Therefore, an OMIC approach

represents the best way to analyze biological effects induced by IR, direct or indirect damage to

principal biological molecules, allowing also to discover new biomarkers prognostic and predictive

of the cell sensibility to IR (40-42).

Microarrays and the genome-scale expression data, represent an important advance in the biological

sciences, not only for the efficient high-throughput data collection available but also for new

avenues useful to interpret the biologic data sets so new and complex. In addition, a lot of

bibliographic data show the power of gene expression profile (GEP) experiments in highlighting the

whole cell response, in term of gene expression changes, after a specific stress or treatment,

representing an useful OMIC approach in understanding complex heterogeneous diseases (43).

At transcriptional level, a number of genes have been shown to be responsive to radiation exposure.

Tsai MH et al have showed distinct differences in molecular response between a single 10 Gy high

dose versus multi-fractions of 5 x 2 Gy dose in breast (MCF7), prostate (DU145) and glioma

(SF539) cells (44). The abovementioned three cell lines responded to these type of treatments with a

large comparable number of differentially expressed genes with a 1.5 or 2 fold change threshold,

within a 24 hrs time course. In addition, a comparison of the time course changes in global

expression patterns by multidimensional scaling analysis revealed differences rather than


13

similarities among the cell lines, as well as between the single and multi-fractions dose regimens.

More precisely, the number of genes up-regulated, by at least 2-fold, after either single or multi-

fraction protocols, common to all three cell lines, was found to be small and composed by only 13

IFN-related genes. This group of genes, which are known to be transcriptionally activated by

STAT1, has been implicated in inflammation and may be associated with radiation resistance. The

consequences of STAT1 elevation after radiation exposure could have profound effects on both

normal and tumor cells. Moreover, although p53 is one radiation-responsive gene, other genes may

also contribute to the radiation response. For example, Tsai MH et al have reported that only MCF7

cells show a cluster of p53-related genes, regulated by both single and multi-fraction schedules,

while no p53-related genes were detected in either SF539 or DU145 cell lines (44). In addition, no

genes were up-regulated by using the larger dose of 10 Gy, whereas there were genes

predominantly up-regulated by the multi-fracionated dose in all the three cell lines. It is considered

of particular interest the Signal Transducer and Activator Transcription 1 (STAT1), up regulated in

all cell lines tested, implicated in inflammation and radiation resistance. The protein encoded by this

gene is a member of the STAT protein family, activated by phosphorylation in response to

cytokines and growth factors, by the receptor associated kinases. Once activated, it forms homo- or

heterodimers and translocate to the cell nucleus where it acts as a transcription activator. Moreover,

this gene also interacts with ATM protein following DNA damage and participates t in the repair of

IR DNA damage (6,44).

Amundson SA et al, by applying Fluorescent cDNA microarray hybridization on human myeloid

cell line (ML-1) assayed 4 hrs after 20 Gy IR exposure, selected 48 transcripts significantly changed

by radiation treatment previously known to be radiation inducible, as well as many genes not

previously reported as IR regulated. Some of these coded for proteins involved in cell cycle, cell

fate, transcriptional regulation and generally in intracellular signalling cascades that could play an

important role in the induction and development of cell radiation effects (45).

Interestingly, the majority of the IR-responsive genes showed p53-independent regulation. The

induction of these selected stress-response genes was next measured by the authors in a panel of 12

cancer cell lines, derived from myeloid-lymphoid lineage, lung cancer, breast carcinoma and colon

cancer in order to determine their role in IR-response. Particularly, only the SSAT, MBP-1, c-IAP1,

RELB and BCL3 genes were primarily IR induced in all of the 12 cell lines examined (44).

Moreover, the involvement of some above described IR responsive genes was also confirmed by

Jen KY and Cheung VG (46) in lymphoblastoid cells assayed at various time points within 24 hrs

after irradiation, using 3 Gy and 10 Gy. Specifically, 10 Gy induced a number of DNA repair genes,

(such as factors involved in HR mechanism and previously described like RAD51C and XPC),


14

which were not affected at the 3 Gy dose, and many cell death related genes, including a large

group of anti-apoptotic and autophagy genes. In addition, the p53-regulated genes, MDM2 and

PCNA, displayed increased expression levels. Following 10 Gy treatment, several MAP kinase and

MAP kinase-related genes are transcriptionally induced: this signalling control survival and

repopulation following radiation as previously described. Increased transcript levels of a group of

oxidative stress genes were also reported in lymphoblastoid cells after 10 Gy of IR. Moreover,

although some IR-responsive genes display different temporal expression patterns, depending on

the dose of IR exposure, some groups of genes show very similar temporal expression patterns

relative to each other at both the 3 Gy and 10 Gy IR doses. One hundred and twenty six IR-

responsive genes were in common between the two doses, including p53-dependent genes, which

play important roles in cell cycle arrest and DNA repair, general stress response genes and cell

cycle-related genes (46).

The high variability of transcriptional responses described in different cell lines emphasizes that a

single cell line or cell type cannot provide a general model of response to IR stress.

The emergence of novel biomarkers to predict cancer cell sensitivity to IR could help to improve

therapy results in cancer patients receiving RT. The proteomic approach could be effectively used

to identify proteins associated with cancer radiation resistance and sensitivity (47-48).

Several studies reported the biological effectiveness of IR using a proteomic approach. A global

analysis of the protein expression pattern was performed by Jung et al, using 2D-PAGE and MS to

identify radiation-responsive proteins in MCF7 BC cell line irradiated with different doses of γ-rays

of 1, 5, 10, or 20 Gy, in which the cell growth was repressed after exposure to 20 Gy of radiation

(49). The IR treatment of the MCF-7 cells did not affect cell viability, but the cell growth was

repressed due to cell cycle arrest at the G2 phase, suggesting that IR-irradiated MCF7 cells undergo

cell cycle arrest rather than apoptosis. In order to establish the factors responsible for this phenotype

the authors identified the radiation-responsive proteins in γ-irradiated MCF7 cells. In particular, one

set of proteins was up-regulated and another set of proteins down-regulated after exposure to γ-rays.

These proteins are known to be related to cell cycle control, apoptosis, DNA repair, cell

proliferation and other signaling pathways, defining a molecular signature, at protein level, of

MCF7 response to this type of treatment with γ-rays (49).

Liao et al performed a proteomic study in MDA-MB-231 BC cell line irradiated with 6 Gy of X-

rays and reported the metabolic alterations induced by this radiation treatment. The authors found

that X-rays irradiation induced senescence of MDA-MB-231 cells and the activation of

glyceraldehyde-3-phosphate dehydrogenase and lactate dehydrogenase, involved in glycolysis and

in the conversion of pyruvate to lactate, allowing the lactate release and the acidification of the


15

extracellular environment. In addition, 6 Gy X-ray irradiation induced activation of the 50-

adenosine monophosphate-activated protein kinase (AMPK) and nuclear factor kappa B (NF-kB),

senescence-promoting factors. Interestingly, these metabolic alterations were also detected in non-

irradiated, surrounding cells and promoted their invasiveness. Therefore, changes in metabolism are

crucial for both radiation-induced senescence and the bystander effect (50).

Epigenetic changes IR-induced

Epigenetic changes are heritable structural and functional genome modifications occuring without

changes in DNA sequence, directly affecting gene expression by mechanisms comprising histone

modifications, DNA methylation and the annealing of noncoding antisense RNAs. Aberrant

epigenetic events cause global changes in chromatin packaging and in specific gene promoters,

influencing the transcription of genes involved in cancer development. Two principal types of

changes in the DNA methylation pattern occur in cancer cells: hypo- and hyper-methylation of

specific genes (51-54). It has been observed in mouse models that IR treatment with 6 Gy dose may

induce effects on global hypomethylation in a sex, tissue-specific and dose-dependent manner. Most

of radiation-induced epigenetic changes have been found associated with loss of methylation and

decrease in expression levels of some methyltransferases, including DNMT1,DNMY3a, DNMT3b

and the methyl CpG binding proteins (MeCP2) (55-56).

However, few data are available on DNA methylation changes after IR exposure in human cancer

cells. In a recent study conducted on the MDA-MB-231 human BC cell line following irradiation at

2 and 6 Gy, global DNA methylation changes (at>450,000 loci) have been analized to determine

potential epigenetic response to IR. The study has revealed significant differentially methylated

genes related to cell cycle, DNA repair and apoptosis pathways. The degree of methylation variance

of these pathways changes with radiation dose and time post-irradiation, suggesting that DNA

methylation changes exert an important epigenetic role in cell response to radiation (57). In the

MCF7 human BC cells treated with different fractionated IR doses (until 20 Gy), several locus-

specific DNA methylation alterations have been observed, which predominantly were loss of

methylation of TRAPP9, FOXC1 and LINE1 loci (58). Recently, it has been reported that

radiosensitive and radioresistant cancer cells may acquire epigenetic changes at different genomic

regions, in dependence of time after irradiation and cell genetic background (60). In addition, in

some human colon cancer cell lines (HCT116, SW480, L174T, Co115), a relationship between

enhanced cell radiation sensitivity and genomic hypomethylation induced by the DNA

methyltransferase inhibitor 5-aza-cytidine (AZA) has been observed (61). Similar results were also

shown by the study of Cho HJ et al conducted on the RKO colon cancer and the MCF-7 BC cell


16

lines, where the AZA treatment in combination with the use of the histone deacetylase (HDAC)

inhibitorsodium butyrate (SB), was able to enhance radiosensitivity in both MCF-7 and RKO cell

lines. The authors also noted that the combined effect caused by the demethylating agent and the

HDAC inhibitor is more effective than the use of a single agent in both cancer cell lines (62). These

data suggest that, the defining of specific factors regulating gene expression by DNA epigenetic

changes may be a useful target for tumor radiosensitization (54).

Conclusion

The main goal of RT treatments is to deprive cancer cells of their reproductive potential inducing

cell death. IR activates complex cross-linked intracellular networks able to define cell fate

establishing the choice between survival or death. However, the contribution of these genes and

signaling pathways, especially those controlling different cellular death mechanisms, need to be

further investigated. Moreover, the molecular response to ionizing radiation is highly complex,

heterogeneous and highly dependent on cell type. Today, an OMIC approach represents the best

way to analyze biological effects induced by IR, direct or indirect damage to principal biological

molecules, allowing also to discover new biomarkers prognostic and predictive of the cell

sensibility to IR.

References

1. Hall EJ and Giaccia AJ: Radiobiology for the Radiologist. 6th ed.Lippincott Williams & Wilkins

Philadelphia (PA, USA), 16-180, 2006.

2.Giaccia AJ: Molecular radiobiology: the state of the art. J Clin Oncol 32 (26), 2871-8, 2014.

3.Zhao W, Diz DI, Robbins ME. Oxidative damage pathways in relation to normal tissue injury. Br

J Radiol 80 Spec No 1:S23-31, 2007.

4.Lomax ME, Folkes LK, O'Neill P. Biological consequences of radiation-induced DNA damage:

relevance to radiotherapy. Clin Oncol (R Coll Radiol) 25(10):578-85, 2013.

5.Huang L, Snyder AR, Morgan WF. Radiation-induced genomic instability and its implications for

radiation carcinogenesis. Oncogene 22(37):5848-5, 2003.

6.Minafra L and Bravatà V: Cell and molecular response to IORT treatment. Transl Cancer Res 3,

32-47, 2014.

7.Shuryak I and Brenner DJ. Mechanistic analysis of the contributions of DNA and protein damage

to radiation-induced cell death. Radiat Res 178 (1):17-24, 2012.

8.Polo SE, Jackson SP. Dynamics of DNA damage response proteins at DNA breaks: a focus on

protein modifications. Genes Dev 25(5):409-33, 2011.


17

9.Kakarougkas A, Jeggo P. DNA DSB repair pathway choice: an orchestrated handover

mechanism. Br J Radiol 87 (1035):20130685, 2014.

10.Martin LM, Marples B, Coffey M, Lawler M, Lynch TH, Hollywood D, Marignol L. DNA

mismatch repair and the DNA damage response to ionizing radiation: making sense of apparently

conflicting data. Cancer Treat Rev 36(7):518-27, 2010.

11.Lavin MF. ATM and the Mre11 complex combine to recognize and signal DNA double-strand

breaks. Oncogene 26 (56):7749-58, 2007.

12.West CM and Barnett GC. Genetics and genomics of radiotherapy toxicity: towards prediction.

Genome Medicine 3:52, 2011.

13.Lee JH, Paull TT. Activation and regulation of ATM kinase activity in response to DNA double-

strand breaks. Oncogene 26 (56):7741-8, 2007.

14.Cowell IG, Sunter NJ, Singh PB, Austin CA, Durkacz BW, Tilby MJ. gammaH2AX foci form

preferentially in euchromatin after ionising-radiation. PLoS One 2(10):e1057, 2007.

15.Pflaum J, Schlosser S, Müller M: p53 Family and Cellular Stress Responses in Cancer. Front

Oncol 4, 285, 2014.

16. Gupta A, Hunt CR, Chakraborty S, Pandita RK, Yordy J, Horikoshi N, Pandita TK. Role of

53BP1 in the Regulation of DNA Double-Strand Break Repair Pathway Choice. Radiat Res

181(1):1-8, 2014.

17.Surova O, Zhivotovsky B. Various modes of cell death induced by DNA damage. Oncogene

32(33):3789-97, 2013.

18.Gudmundsdottir K, Ashworth A. The roles of BRCA1 and BRCA2 and associated proteins in

the maintenance of genomic stability. Oncogene 25(43):5864-74, 2006.

19.Karami F, Mehdipour P. A Comprehensive Focus on Global Spectrum of BRCA1 and BRCA2

Mutations in Breast Cancer. Biomed Res Int 2013:928562, 2013.

20.Eriksson D, Stigbrand T. Radiation-induced cell death mechanisms. Tumour Biol 31(4):363-72,

2010.

21.Stewart RD, Yu VK, Georgakilas AG, Koumenis C, Park JH, Carlson DJ. Effects of radiation

quality and oxygen on clustered DNA lesions and cell death. Radiat Res 176(5):587-602, 2011.

22.Fuchs Y, Steller H. Programmed cell death in animal development and disease. Cell 147(4):742-

58, 2011.

23.Sinha K, Das J, Pal PB, Sil PC. Oxidative stress: the mitochondria-dependent and mitochondria-

independent pathways of apoptosis. Arch Toxicol 87(7):1157-80, 2013.

24.Riedl SJ, Salvesen GS. The apoptosome: signalling platform of cell death. Nat Rev Mol Cell

Biol 8(5):405-13, 2007.


18

25.Golden EB, Pellicciotta I, Demaria S, Barcellos-Hoff MH, Formenti SC. The convergence of

radiation and immunogenic cell death signaling pathways. Front Oncol 7;2:88, 2012.

26.Cuddihy AR, Bristow RG. The p53 protein family and radiation sensitivity: Yes or no? Cancer

Metastasis Rev 23:237-57, 2004.

27.Vanden Berghe T, van Loo G, Saelens X, Van Gurp M, Brouckaert G, Kalai M, Declercq W,

Vandenabeele P. Differential signaling to apoptotic and necrotic cell death by Fas-associated death

domain protein FADD. J Biol Chem 279(9):7925-33, 2004.

28.Galluzzi L, Kroemer G. Necroptosis: a specialized pathway of programmed necrosis. Cell

135(7):1161-3, 2008.

29.Campisi J. Aging, cellular senescence, and cancer. Annu Rev Physiol 75:685-705, 2013.

30.Rodier F, Campisi J. Four faces of cellular senescence. J Cell Biol 192(4):547-56, 2011.

31.Tchkonia T, Zhu Y, van Deursen J, Campisi J, Kirkland JL. Cellular senescence and the

senescent secretory phenotype: therapeutic opportunities. J Clin Invest 123(3):966-72, 2013.

32.Dodson M, Darley-Usmar V, Zhang J. Cellular metabolic and autophagic pathways: traffic

control by redox signaling. Free Radic Biol Med 63:207-21, 2013.

33.Denton D, Nicolson S, Kumar S. Cell death by autophagy: facts and apparent artefacts. Cell

Death Differ 19(1):87-95, 2012.

34.Rodriguez-Rocha H, Garcia-Garcia A, Panayiotidis MI, Franco R. DNA damage and autophagy.

Mutat Res 2011;711(1-2):158-66, 2011.

35.Palumbo S, Comincini S. Autophagy and ionizing radiation in tumors: the "survive or not

survive" dilemma. J Cell Physiol 228(1):1-8, 2013.

36.Castedo M, Perfettini JL, Roumier T, Andreau K, Medema R, Kroemer G. Cell death by mitotic

catastrophe: a molecular definition. Oncogene 23 (16):2825-37, 2004.

37.Mansilla S, Priebe W, Portugal J. Mitotic catastrophe results in cell death by caspase-dependent

and caspase-independent mechanisms. Cell Cycle 5(1):53-60, 2006.

38.Vakifahmetoglu H, Olsson M, Zhivotovsky B. Death through a tragedy: mitotic catastrophe. Cell

Death Differ 15 (7):1153-62, 2008.

39.Vitale I, Galluzzi L, Castedo M, Kroemer G. Mitotic catastrophe: a mechanism for avoiding

genomic instability. Nat Rev Mol Cell Biol 12(6):385-92, 2011.

40.Nesvizhskii AI. Proteogenomics: concepts, applications and computational strategies. Nat

Methods 11(11), 1114-25, 2014.

41.Renuse S, Chaerkady R, Pandey A. Proteogenomics. Proteomics 11 (4), 620-30, 2011.

42.Faulkner S, Dun MD, Hondermarck H. Proteogenomics: emergence and promise. Cell Mol Life

Sci 72, 953–957, 2015.


19

43.Sparano JA, Ostrer H, Kenny PA. Translating genomic research into clinical practice: promise

and pitfalls. Am Soc Clin Oncol Educ Book 15-23, 2013.

44.Tsai MH, Cook JA, Chandramouli GV, DeGraff W, Yan H, Zhao S, Coleman CN, Mitchell JB,

Chuang EY. Gene expression profiling of breast, prostate, and glioma cells following single versus

fractionated doses of radiation. Cancer Res 67(8):3845-52, 2007.

45.Amundson SA, Bittner M, Chen Y, Trent J, Meltzer P, Fornace AJ Jr. Fluorescent cDNA

microarray hybridization reveals complexity and heterogeneity of cellular genotoxic stress

responses. Oncogene 18:3666-3672, 1999.

46.Jen KY, Cheung VG. Transcriptional response of lymphoblastoid cells to ionizing radiation.

Genome Res 13:2092-2100, 2003.

47.Chevalier F: Highlights on the capacities of "Gel-based" proteomics. Proteome Sci Apr 28, 8-23,

2010.

48.Skvortsov S, Debbage P, Cho WC et al. Putative biomarkers and therapeutic targets associated

with radiation resistance. Expert Rev Proteomics 11 (2), 207-14, 2014.

49.Jung S, Lee S, Lee J,et al. Protein expression pattern in response to ionizing radiation in MCF-7

human breast cancer cells. Oncol Lett 3(1), 147-154, 2012.

50.Liao EC, Hsu YT, Chuah QY et al. Radiation induces senescence and a bystander effect through

metabolic alterations. Cell Death Dis 22, 5:e1255, 2014.

51.Surani MA, Hayashi K, Hajkova P. Genetic and epigenetic regulators of pluripotency. Cell

128(4):747-62, 2007

52.Kouzarides T. Chromatin modifications and their function. Cell 128(4):693-705, 2007.

53.Jones PA, Baylin SB. The epigenomics of cancer. Cell 128 (4):683-92, 2007.

54.Valdespino V and Valdespino PM. Potential of epigenetic therapies in the management of solid

tumors. Cancer Manag Res 7:241-51, 2015.

55.Pogribny I, Raiche J, Slovack M, Kovalchuk O. Dose-dependence, sex- and tissue-specificity,

and persistence of radiation-induced genomic DNA methylation changes. Biochem Biophys Res

Commun 320(4):1253-61, 2004.

56.Raiche J, Rodriguez-Juarez R, Pogribny I, Kovalchuk O. Sex- and tissue-specific expression of

maintenance and de novo DNA methyltransferases upon low dose X-irradiation in mice. Biochem

Biophys Res Commun 325(1):39-47, 2004.

57.Antwih DA, Gabbara KM, Lancaster WD, Ruden DM, Zielske SP. Radiation-induced epigenetic

DNA methylation modification of radiation-response pathways. Epigenetics 8(8):839-48, 2013.


20

58.Kuhmann C, Weichenhan D, Rehli M, Plass C, Schmezer P, Popanda O. DNA methylation

changes in cells regrowing after fractioned ionizing radiation. Radiother Oncol 101(1):116-21,

2011.

59.Chaudhry MA, Omaruddin RA. Differential DNA methylation alterations in radiation-sensitive

and -resistant cells. DNA Cell Biol 31(6):908-16, 2012.

60.Hofstetter B, Niemierko A, Forrer C, Benhattar J, Albertini V, Pruschy M, Bosman FT,

Catapano CV, Ciernik IF. Impact of genomic methylation on radiation sensitivity of colorectal

carcinoma. Int J Radiat Oncol Biol Phys 76(5):1512-9, 2010

61.Cho HJ, Kim SY, Kim KH, Kang WK, Kim JI, Oh ST, Kim JS, An CH. The combination effect

of sodium butyrate and 5-Aza-2'-deoxycytidine on radiosensitivity in RKO colorectal cancer and

MCF-7 breast cancer cell lines. World J Surg Oncol 7:49, 2009


21

Experimental approach to study the inflammatory breast response to radiation

Francesco P Cammarata1, Luigi Minafra1, Federica M Di Maggio1, Giorgio Russo1, Cristina

Messa1,2,3, Maria C Gilardi1,3,4 Giusi Irma Forte1 and Valentina Bravatà*1



Abstract

Ionizing radiation activates both pro-and anti-proliferative signal pathways

producing an imbalance in cell fate decision. Intraoperative Electron

Radiation Therapy (IOERT) is a therapeutic technique which administers a

single high dose of ionizing radiation (IR) immediately after surgical removal

of a tumor. Radiation therapy can modulate anti-tumour immune responses,

modifying tumour and its microenvironment. IR treatment activates

inflammatory processes causing the release of a great amount of molecules

able to affect the cell survival/cell death balance, as well as metastasis and/or

fibrosis induction. Understanding the complex relationship between IR,

inflammation and immune responses in cancer, opens up new avenues for

radiation research and therapy in order to optimize and personalize radiation

therapy treatment for each patient.



22

Introduction

Radiation therapy (RT) is a treatment modality used for many types of cancer: more than 50% of

cancer patients receive RT, often used in combination with surgery and chemotherapy (1).

Besides the direct effects of radiation in reducing cancer cell viability, RT may induce

modifications on local microenvironments that can affect tumor development (2-3). Ionizing

radiations (IR), mainly used in conventional external beam RT and high-energy electrons generated

by intraoperative radiotherapy (IORT) linear accelerators, are able to induce high stress levels on

both tumor and normal cells. IORT performed with electron linear accelerator (IOERT), is a

therapeutic technique that consists in administering a single high dose of IR immediately after

surgical tumor removal to destroy the residual cancer cells that may be left in the tumor site (4-8).

Breast cancer (BC) represents a highly heterogeneous tumor at both clinical and molecular levels

(9-13). According to specific eligibility criteria, IOERT BC treatments may be conducted using two

modalities. On the one hand, a single radiation dose of 21-23 Gray (Gy), corresponding to the

administration of the entire sequence of a conventional adjuvant RT, could be delivered during the

exclusive IOERT treatment. On the other hand, IOERT may be conducted as a boost of 9-12 Gy,

followed by conventional external RT treatment (14-16).

IR activate both pro- and antiproliferative signal pathways altering the homeostatic balance between

survival and cell death, regulated by several genes and factors involved in cell cycle progression,

DNA repair, inflammation and cell death induction (16). It has long been recognized that the

immune system plays a pivotal role in tumours. On the one hand, immunological factors can

suppress tumour development by killing cancer cells or inhibiting their growth. On the other hand,

immune cells are able to induce an immunosuppressive microenvironment that contributes to

promote tumour progression (17-19). More precisely, inflammatory cytokines, growth factors and

proteases can affect cancer cell invasion, bystander effect, as well as radiation tissue complications

such as fibrosis, genomic instability and thus can greatly influence intrinsic cellular radiosensitivity

(20-21). Indeed, it is well known that IR has direct effects on DNA damage altering the phenotype

of tumor irradiated cells (targeted effects) (19-20). The RT effects may also be detected in non-

irradiated cells adjacent to irradiated cells. This phenomenon is called “bystander effect”, and it has

been observed in a wide range of cell types with several biological end points (DNA damage,

genomic instability, oncogenic transformation and cell death) (3). The cytokine profile in the tumor

microenvironment is highly dynamic and subjected to multiple changes during tumor development.

Moreover, in response to stress such IR exposure, tumor cells modulate their own cytokine

secretion in order to control the cancer therapy outcome (21-22). These secreted factors also interact


23

with surrounding cells and hence, may determine the magnitude of damage to non-targeted tissue

via the bystander effect (21-22).

The aim of this study was to highlight, for the first time to our knowledge, the cytokine profile

secreted in conditioned medium by the human MCF10A mammary epithelial cell line, MCF7 and

MDA-MB-231 BC cell lines after single high radiation doses delivered by IOERT. We trust that

this study could open the possibility to modulate the anticancer IR personalized therapy on the basis

of cytokine signature analyses.

Materials and Methods

IOERT treatment. The NOVAC7 Intraoperative Electron Radiation Therapy (IOERT) system

producing electron beams of 4, 6, 8 and 10 MeV nominal energies was used to perform treatments

at different tissue depths. The beam collimation was performed through a set of polymethyl

methacrylate (PMMA) applicators: cylindrical tubes with a diameter ranging from 3 to 10 cm and

face angle of 0°- 45°. Cell irradiation setup and the dose distribution were conducted as previously

reported (9, 41, 42). IOERT cell treatments were conducted with two dose values, 9 Gy (in boost

scheme) and 23 Gy (according to the exclusive modality) to the 100% isodose at a dose rate of 3.2

cGy/pulse.

Cell culture and collection of irradiated conditioned media. The human non-tumorigenic breast

epithelial MCF10A cell line and human breast adenocarcinoma MCF7 and MDA-MB-231 cell

lines, characterized by different tumorigenic aggressive phenotypes (23), were purchased from the

American Type Culture Collection (Manassas, VA, USA) and cultured according to ATCC

instructions. All cell culture media and supplements were obtained from Invitrogen (Carlsbad, CA,

USA). Cells were maintained in an exponentially growing culture condition at 37˚C in a 5% CO2

incubator and were IOERT irradiated at subconfluence under sterile conditions. MCF10, MCF7 and

MDA-MB-231 treated cells were named as follows: MCF10A 9 Gy, MCF10A 23 Gy; MCF7 9 Gy,

MCF7 23 Gy; MDA-MB-231 9 Gy and MDA-MB-231 23 Gy. Forty-eight hours before irradiation,

cells (1x106 cells) were seeded in 100-mm Petri dishes, one for each collection time post-treatments

(30 min, 1, 3, 6, 24, 48 and 72 h). Twenty-four hours before irradiation, the medium was replaced

with a fresh one. At the defined times after exposure to 9 and 23 Gy IR doses, irradiated

conditioned media (ICM) were collected and stored at -80°C until use. In addition, in the case of

radioresistant cell fractions (RCF) of MCF10A 9 Gy and MDA-MB-231 9 Gy (named MCF10A

RCF and MDA-MB-231 RCF respectively), at 7, 14, 21 and 28 days post IOERT the ICM was

collected as described above. One Petri dish with cells seeded and grown under the same


24

experimental conditions was obtained for each cell line and the complete conditioned medium (CM)

was collected and used as control (basal, i.e. untreated). Moreover, complete media without cells

were incubated under the same experimental conditions and used as the blank controls.

Clonogenic survival assay and morphological evaluation. The clonogenic survival assay was

performed as previously described (8, 24). Briefly, 24 h after irradiation, treated cells were seeded

in triplicate at a density of 200-1000 cells per well in a 6-well plate to assay the surviving fraction

(SF). Considering the high doses delivered, the clonogenic assay was also performed plating up to

10x104 cells in 100-mm Petri dishes. As control, untreated cells were seeded in the same conditions

in order to evaluate the plating efficiency (PE). Colonies were allowed to grow under normal cell

culture conditions for two or three weeks and then were fixed and stained for 30 min with 6%

glutaraldehyde and 0.5% crystal violet (both from Sigma-Aldrich, St. Louis, MO, USA). Colonies

with more than 50 cells were counted manually under a Zeiss Axiovert phase-contrast microscope

(Carl Zeiss, Germany). Moreover, to detect the cell radiation effect, cells throughout the course of

the assays were monitored for cell morphology and growth pattern by taking photographs in random

fields for each treatment under a Zeiss Axiovert phase-contrast microscope (Carl Zeiss, Germany).

Cytokine, chemokine and growth factor analysis. Media were collected after the following time

points post-exposure to 9 and 23 Gy IR doses: 30 min, 1, 3, 6, 24, 48 and 72 h. In addition, for

MCF10A and MDA-MB-231 RCF fractions, media were collected using the following time points:

7, 14, 21 and 28 days after exposure to 9 Gy IR dose. CM and ICM were stored at -80°C until use.

Immediately before the cytokine assay, thawed samples were centrifuged at 12,000 rpm for 5-10

min to allow precipitation of any lipid excess that may interfere with subsequent analysis.

The samples were analyzed using Luminex and ELISA Technologies.

Luminex assays. The samples were tested for a panel of 17 cytokines and chemokines (IL-1b, IL-2,

IL-4, IL-5, IL-6, IL-7, IL-8, IL-10, IL-12(p70), IL-13, IL-17, IFN-γ, TNF-α, monocyte

chemoattractant protein-1 (MCP-1), macrophage inflammatory protein-1b (MIP-1b), granulocyte-

macrophage colony-stimulating factor (GM-CSF), and granulocyte colony-stimulating factor (G-

CSF)) using Bio-plex kit (BioRad, Milan, Italy) and following the manufacturer’s instructions. The

assay was carried out using the Luminex system (BioRad, Munchen, Germany), based on the

measurement of fluorescent signals released by a suspension of microspheres with immobilized

cytokine specific antibodies, in 96-well plates. The combination of the fluorimetric signal of the

microspheres with that released by a secondary antibody allows the measurement of cytokine

concentration–related signals converted by a processor. The assay was performed using an eight-


25

point standard curve for every cytokine. Samples were analyzed on a Luminex 100 device

(BioRad), and the data were evaluated using the Bio-Plex Manager software (BioRad). Standards,

internal controls, and samples are reported as means of duplicate measurements.

ELISA assays. Secreted TGFβ2 and VEGFA were determined by the human TGF-β2 ELISA assay

(RayBiotech, Norcross, GA) and human VEGF ELISA Kit (Boster Biological Technology Co.,

Pleasanton, CA), respectively, following the manufacturer’s instructions. The assays were

performed using an eight-point standard curve for each assay. Standards and samples were loaded

into the 96-well plate, and TGF-β2 and VEGFA molecules in the samples were bound to the wells

by immobilized specific antibodies coated on the plate bottom. Standards and samples were

reported as means of triplicate measurements. At the end of each assay, the intensity of the solution

color changes (from blue to yellow), and were measured at 450 nm using VICTOR3 multilabel

counter instrument (Perkin Elmer, Alameda, CA). Data analyses were performed comparing

MCF10A, MCF7 and MDA-MB-231 ICMs at different collection time points, versus CMs of

untreated cells used as reference samples.

PubMatrix. All proteins assayed in this work were analyzed using the PubMatrix tool (25). In this

way, lists of terms, such as protein names, can be assigned to a genetic, biological, or clinical

relevance in a flexible systematic fashion in order to confirm our assumptions. Thus, bibliographic

relationships between proteins and some selected queries such as IR, radiation, cancer, BC,

inflammation, apoptosis, NF-Kb, STAT-3, MCF10A, MCF7 and MDA-MB-231 were analyzed in

order to draw useful conclusions.

Statistics. Concentration data were collected as mean values +/ - standard deviations from replicated

dosages and expressed as pg/ml. Then, data were reported as expression normalized values of each

cell line with respect to untreated cells. The Mann-Whitney nonparametric test was used to evaluate

differences in cytokine levels between the observed and expected medians from treated and

untreated samples. Differences were considered significant when a p value <0.05 was obtained.

Results

Clonogenic survival assay and morphological analysis of MCF10A, MCF7 and MDA-MB-231

IOERT treated cells. To evaluate MCF10A, MCF7 and MDA-MB-231 cell viability in terms of

reproductive capacity, we performed a clonogenic survival assay according to the method of

Franken et al., as previously described (8, 24). Twenty-four hours after 9 and 23 Gy IOERT

treatments, cells were appropriately seeded and maintained under normal culture conditions from 2-


26

to 3-weeks to observe the treatment effects on colony formation. The results showed that 23 Gy

exposure inhibited the growth and proliferation of MCF10A cells, as their colony-forming ability

was markedly impaired by irradiation and no colonies were observed. On the contrary, following

the 9 Gy boost treatment, a Surviving Fraction (SF=9.6%) was found, indicating the selection of a

surviving radioresistant cell fraction (RCF) with reproductive capacity that we maintained in culture

up to 3-weeks post treatment (data not shown). Moreover, the results showed that 9 and 23 Gy

exposure inhibited the MCF7 cells’ growth and proliferation, as their colony forming ability was

markedly impaired by IOERT and no colonies were observed following both treatments. In the case

of MDA-MB-231 cells, 23 Gy exposure inhibited cell growth and proliferation and no colonies

were found. Otherwise, 3-weeks after the 9 Gy boost treatment, a MDA-MB-231 cell surviving

fraction was observed (SF=6.4%). This represents RCF cells with reproductive capacity that we

maintained in culture up to 3-weeks post treatment. Cell morphology observed after irradiation with

9 Gy and 23 Gy was similar for all cell lines assayed in this work, cell damages at both the

membranous and cytoplasmic levels were observed.

CM inflammatory profile of human MCF10A BC after IOERT treatment. To quantify and evaluate

cytokine, chemokine and growth factor profiles secreted after 9 Gy and 23 Gy of IOERT treatment

by MCF10A cells, ICM were collected after 30 min, 1, 3, 6, 24, 48 and 72 h post-treatments. Based

on their functions, these immune factors were divided into six groups: pro-inflammatory cytokines

(IL-1b, IL-6, and TNF-α), T Helper 1 (Th1) cytokines (IL-12 (p70), and INFγ), T Helper 2 (Th2)

cytokines (IL-4, IL-5, IL-10 and IL-13), chemokines (IL-8, MCP-1 and MIP-1b), immuno-

modulatory cytokines (IL-2, IL-7, IL-17, GM-CSF, G-CSF) and tissue modulating factors (TGF-β2

and VEGFA). Cell media, exposed to 9 Gy and 23 Gy doses, did not show relevant production of

these factors during the early time points after treatments (30 min, 1, 3, 6 h), with respect to

untreated cells, as their quantities were below the range detected by the instrument (data not

shown). Thus, we have reported experimental data obtained at 24, 48 and 72 h time points after

IOERT. The MCF10A cytokine signature was very similar for the two doses used (9 Gy and 23 Gy)

in the post-irradiation time windows analysed (24 -72 h), as it is shown by a similar trend even if, in

such cases, the administration of the 23 Gy dose, causes a major or minor quantity of product

release (Figure 1). Our data suggest that treated cells, with respect to untreated ones, react to

irradiation with a progressive increase of their inflammatory response, sustained by a mild rise of

TNF-α and IL-1b release and a stronger rise of IL-6. An increase of the release of INFγ, IL8, MCP-

1, MIP-1b, IL-2, IL-7, IL-17, TGFβ2 and VEGFA was observed. Otherwise, a down secretion of

IL-4, IL-13, G-CSF and undetectable IL10 and GM-CSF production were also detected.


27

MCF10A RCF inflammatory profile. A surviving cell fraction of the MCF10A cell line was

observed after 9 Gy IOERT treatment. Its cytokine signature was studied at 7, 14, 21 and 28 days

post-irradiation and reported in Figure 2. In comparison with the MCF10A 9 Gy profile discussed

above, during the time range analyzed, the RCF is characterized by moderate pro-inflammatory

signals maintaining a local cell mediated-type immune response, while the systemic inflammatory

molecules seem to return to normal levels. Indeed, the IL-1b and TNF-α production was almost

extinguished and the IL-6 levels remained low until a peak at 14 days post 9 Gy IOERT (Figure 2).

The TH1 response was still sustained by the progressive INF-γ up-regulation, while among the TH2

cytokines, a major IL-13 quantity was observed with respect to those observed during early time

points of the ICM collection (Figure 2). Chemokine concentration levels remained high and reached

a maximum peak at 21 days. Instead, a drop of G-CSF production was observed among the

immune-modulatory cytokines, while IL-2 and IL-7 levels remained almost stable at all time points

studied. Finally IL-17, TGF-β2 and VEGFA remained elevated after 14 days and particularly a

greater quantity of TGF-β2 was produced by the RCF respect to the MCF10A 9 Gy profile.


28

-5

0

5

10

15

20

24h-9Gy 48h-9Gy 72h-9Gy

IL-1b IL-6 TNFα

0

2

4

6

8

10

24h-23Gy 48h-23Gy 72h-23Gy

IL-1b IL-6 TNFα

0

10

20

30

40

50

24h-9Gy 48h-9Gy 72h-9Gy

IL-12 INF-γ

0

10

20

30

40

50

60

24h-23Gy 48h-23Gy 72h-23Gy

IL-12 INF-γ

-2

-1

0

1

24h-9Gy 48h-9Gy 72h-9Gy

TH2

IL-4 IL-13

-1,5

-1

-0,5

0

0,5

1

24h-23Gy 48h-23Gy 72h-23Gy

TH2

IL-4 IL-13

-1000

0

1000

2000

3000

4000

24h-9Gy 48h-9Gy 72h-9Gy

IL-8 MCP-1 MIP-1b

0

1000

2000

3000

4000

24h-23Gy 48h-23Gy 72h-23Gy

IL-8 MCP-1 MIP-1b

-4000

-2000

0

2000

4000

6000

8000

24h-9Gy 48h-9Gy 72h-9Gy

IL-2 IL-7 G-CSF IL-17

-3000

-2000

-1000

0

1000

2000

3000

4000

24h-23Gy 48h-23Gy 72h-23Gy


-300

-200

-100

0

100

200

24h-9Gy 48h-9Gy 72h-9Gy

TGFβ2* VEGFA*

-600

-400

-200

0

200

400

24h-23Gy 48h-23Gy 72h-23Gy

TGFβ2* VEGFA*

Pro

-in

flam

mat

ory

cyto

kin

esTH

1TH

2C

hem

oki

nes

Imm

un

o-m

od

ula

tory

cyto

kin

esTi

ssu

em

od

ula

tin

gfa

cto

rs

Figure 1. ICM Inflammatory profile of human MCF10A mammary epithelial cell line.


29

-20

-10

0

10

20

7 Days 14 Days 21 Days 28 Days

Pro-inflammatory cytokines

IL-1b IL-6 TNFα

-100

-50

0

50

100


TH1

IL-12 INF-γ

-2

0

2

4

6


TH2

IL-4 IL-13

-2000

-1000

0

1000

2000

3000


Chemokines

IL-8 MCP-1 MIP-1b

-6000

-4000

-2000

0

2000


Immuno-modulatory cytokines


-4000

-3000

-2000

-1000

0

1000

2000


Tissue modulating factors

TGFβ2* VEGFA*

Figure 2. ICM Inflammatory profile of human MCF10A RCF cell line.

CM inflammatory profile of human MCF7 BC after IOERT treatment. Even in MCF7 cells IOERT

treated, early time points were characterized by very low molecules release, thus we again

considered only the 24, 48 and 72 h post-treatment time points. The cytokine production of MCF7

cells post- irradiation was quite low. Indeed, the numerous molecules analyzed (IL-1b, TNF-α, IL-

5, IL-4, IL-13, IL-10, MIP-1b, IL-7, IL-17, G-CSF) were undetectable in cell cultures exposed both

at 9 Gy and 23 Gy. With respect to untreated cells, the relative production of the other factors was

reduced and molecule release trends were very similar between the 9 Gy and 23 Gy treatments.

Notably, a small quantities of IL-6, IL-8, MCP-1, GM-CSF and IL17 were produced and a small

amount of INF-γ and IL-2 was observable. Otherwise, a significant and progressive increase of

TGF-β2 and VEGFA levels after 24 h post IOERT were observed in MCF7 cells (Figure 3).


30

Pro

-in

fla

mm

ato

rycy

tok

ine

sT

H1

Ch

em

ok

ine

sIm

mu

no

-mo

du

lato

rycy

tok

ine

sT

issu

em

od

ula

tin

gfa

cto

rs

0

0,5

1

1,5

24h-9Gy 48h-9Gy 72h-9Gy


IL-6

0

0,5

1

1,5

24h-23Gy 48h-23Gy 72h-23Gy


IL-6

0

0,5

1

1,5

24h-9Gy 48h-9Gy 72h-9Gy

TH1

IL-12 INF-γ

-6

-4

-2

0

2

24h-23Gy 48h-23Gy 72h-23Gy

TH1

IL-12 INF-γ

0

0,5

1

1,5

2

2,5

24h-9Gy 48h-9Gy 72h-9Gy

Chemochines

IL-8 MCP-1

0

0,5

1

1,5

2

2,5

24h-23Gy 48h-23Gy 72h-23Gy

Chemochines

IL-8 MCP-1

-2

0

2

4

6

8

24h-9Gy 48h-9Gy 72h-9Gy


IL-2 GM-CSF IL-17

-2

0

2

4

6

8

24h-23Gy 48h-23Gy 72h-23Gy


IL-2 GM-CSF IL-17

-1000

-500

0

500

1000

1500

24h-9Gy 48h-9Gy 72h-9Gy


TGFβ2* VEGFA*

-500

0

500

1000

1500

24h-23Gy 48h-23Gy 72h-23Gy


TGFβ2* VEGFA*

Figure 3. ICM Inflammatory profile of human MCF7 breast cancer cell line.


31

CM Inflammatory profile of human MDA-MB-231 BC cell lines after IOERT treatment. Similar to

MCF10A and MCF7, MDA-MB-231 immunological molecules secretion in the media was very

low during the early time points investigated (30 min, 1, 3, 6, 24 h) after 9 Gy and 23 Gy of IOERT

treatments with respect to untreated MDA-MB-231 cells. Thus, we reported the expression values

at 24, 48 and 72 h post-irradiation of the immunological factors investigated in this work. Similar

trends can be described following the 9 Gy and 23 Gy treatments. Inflammation was sustained by

the progressive increasing of TNFα, IL-1b and significantly, of the IL-6 levels. TH1 response was

organized by the INF-γ rising levels, whereas the TH2 type cytokines did not show consistent

changes with respect to untreated cells, even if an IL-10 production was detected for MDA-MB-231

cells. Furthermore, a cell mediated response was guaranteed by a strong increase of the chemokines

IL8, MCP-1, MIP-1b and of Immuno-modulatory IL-17 cytokine. Growth factors (IL-2, IL-7, G-

CSF, GM-CSF) production was progressively enhanced at 24-72 h after the 9 Gy treatment. TGF-

β2 and VEGFA behaviors were similar following the treatments with 9 Gy and 23 Gy. Their levels

were significantly higher than untreated cells, even if they moderate decreased at 48 h post

irradiation with 23 Gy (Figure 4).

.

MDA-MB-231 RCF inflammatory profile. As described for the MCF10A RCF cells, also for the

MDA-MB-231 cells treated with 9 Gy, a radioresistant cell fraction was observed. The cytokine

signature was tested at 7, 14, 21 and 28 days post-irradiation. Table 6 shows that the MDA-MB-231

RCF cells produced a greater amount of almost all the molecules analyzed compared to the other

cell lines studied in this work, except for a down regulation of IL-8 production. In particular,

increased levels of IL-6, IL-1b, TNF-α, G-CSF, GM-CSF, TGF-β2 and VEGFA were observed. On

the other hand, the increased production of IL-10 did not seem sufficient to be able to balance the

inflammatory response generated by these cells. Overall, MDA-MB-231 RCF cells showed the

strongest inflammatory profile compared to the other cell fractions analyzed in this study.

Finally, while the MCF10A RCF cells showed signs of normalization of the inflammatory profile at

the late time points investigated (7-28 days post treatment) with respect to that observed within 24h,

on the contrary the MDA-MB-231 RCF cells showed a constantly high inflammation signal release

(Figure 5).


32

Pro

-in

fla

mm

ato

rycy

tok

ine

sT

H1

TH

2C

he

mo

kin

es

Imm

un

o-m

od

ula

tory

cyto

kin

es

Tis

sue

mo

du

lati

ng

fact

ors

0

500

1000

1500

24h-9Gy 48h-9Gy 72h-9Gy


IL-1b IL-6 TNFα

0

500

1000

24h-23Gy 48h-23Gy 72h-23Gy


IL-1b IL-6 TNFα

0

50

100

150

24h-9Gy 48h-9Gy 72h-9Gy

TH1

IL-12 INF-γ

0

50

100

24h-23Gy 48h-23Gy 72h-23Gy

TH1

IL-12 INF-γ

-1

0

1

2

24h-9Gy 48h-9Gy 72h-9Gy

TH2

IL-4 IL-10 IL-13

-0,5

0

0,5

1

24h-23Gy 48h-23Gy 72h-23Gy

TH2

IL-4 IL-10 IL-13

0

2000

4000

6000

24h-9Gy 48h-9Gy 72h-9Gy

Chemokines

IL-8 MCP-1 MIP-1b

0

1000

2000

3000

24h-23Gy 48h-23Gy 72h-23Gy

Chemokines

IL-8 MCP-1 MIP-1b

0

100

200

24h-9Gy 48h-9Gy 72h-9Gy


IL-2 IL-7 G-CSF

GM-CSF IL-17

0

100

200

24h-23Gy 48h-23Gy 72h-23Gy


IL-2 IL-7 G-CSF

GM-CSF IL-17

0

1000

2000

3000

24h-9Gy 48h-9Gy 72h-9Gy


TGFβ2 VEGFA

0

1000

2000

3000

24h-23Gy 48h-23Gy 72h-23Gy


TGFβ2 VEGFA

Figure 4. ICM Inflammatory profile of human MDA-MB-231 breast cancer cell line.


33

0

5000

10000

15000

20000

25000



IL-1b IL-6 TNFα

-200

-100

0

100

200

300

400


TH1

IL-12 INF-γ

-4

-2

0

2

4

6

8


TH2

IL-4 IL-10 IL-13

-1000

-500

0

500

1000

1500


Chemokines

IL-8 MCP-1 MIP-1b

-5000

0

5000

10000

15000



IL-2 IL-7 GM-CSF G-CSF IL-17

0

1000

2000

3000

4000

5000



TGFβ2 VEGFA

Figure 5. ICM Inflammatory profile of human MDA-MB-231 RCF cell line.

Discussion

Inflammatory reaction induced by RT is mediated by many inflammation-related cytokine genes,

within minutes to hours after an exogenous stress signal. The balance between pro-inflammatory

and antiinflammatory cytokines is critical in determining a positive or a negative outcome, adverse

reaction and resistance to radiation treatment (26). Many different factors can influence the cytokine

profiles produced after radiation exposure. For example, radiation dose, tissue type and the inborn

characteristics of tumour cells can influence the local response into a pro- or anti-tumour effect (2,

27).

Moreover, the analysis of the cancer cytokine signature is a topic of interest in order to better

understand the cytokine role in cancer progression and radioresistance mechanisms (28). In order to

explore this issue, we studied the radiation-induced cytokine profile of three different cell lines: the

MCF10A non tumorigenic mammary epithelial cells and the two MCF7 and MDA-MB-231

tumorigenic BC cell lines. The 19 molecules assayed in this work were chosen according to their

involvement in cell radiation response, as described by several authors (29-30). In addition, based


34

on their functions, the analytes were divided into the following six groups: pro-inflammatory (IL-

1b, IL-6, and TNF-α);TH1 (IL-12 (p70), and INFγ); TH2 (IL-4, IL-5, IL-10 and IL-13); chemokines

(IL-8, MCP-1 and MIP-1b); immuno-modulatory cytokines (IL-2, IL-7, IL-17, GM-CSF, G-CSF)

and tissue modulating factors (TGF-β2 and VEGFA).

Furthermore, we tested the effects of two doses, 9 Gy (representative of the IOERT boost scheme

irradiation) and 23 Gy (representative of the exclusive treatment modality), in order to evaluate

differences in the immune response profiles in terms of dose-effects.

Concerning the cell line differences observed, three different cytokines signatures can be described

for the three cell lines analyzed. Particularly, respect to the non-tumorigenic MCF10A cells, MCF7

BC cells showed strongly reduced inflammatory signals, both in terms of systemic and local

inflammation. On the other hand, the much aggressive MDA-MB-231 BC cell line were

characterized by an exacerbated inflammation signature, as these cells produce much higher levels

of factors able, in vivo, to mediate stronger systemic and local cell responses (31).

Our data seem to suggest that the cytokine production profile of the MCF10A cell line, often used

as a model of normal breast epithelial cells (24), could represent how normal breast tissue cells

react to high doses of radiation. More precisely, MCF10A profile is quite moderate and

characterized by signals related to a local inflammation and cell mediated response, while only a

mild increase of IL-6 release might be considered to mimick a systemic response.

The stronger IR inflammatory signature of MDA-MB-231 BC cells with respect to MCF7, might be

considered related to their particular aggressive phenotype, as described by several authors (23).

Moreover, concerning the behavior of non-tumorigenic and tumorigenic RCFs, monitored at a very

late time window (7-28 days), consistent differences were revealed between the two cell lines

investigated. Indeed, for the MCF10A RCF cells we observed moderate pro-inflammatory signal

release mimicking a local cell mediated-type immune response, while cytokines involved in

systemic inflammatory molecules seem to return to normal levels. Otherwise, MDA-MB-231 cells

showed signs of an uncontrolled high release of both local and systemic inflammation mediators.

The long term observation of these RCFs might be considered a useful model showing the

differences of cytokine signature between high doses of IR resistant non-tumorigenic and

tumorigenic cell lines. Our data allow us to speculate that these difference in molecules release

might modify the peri-tumoral microenvironment that could influence the natural history and

outcome of the disease, affecting the survival/cell death equilibrium, or modulating invasiveness or

fibrosis. A last remarkable consideration on our results concerns the observation that the dose-effect

affects the cell killing efficiency rather than the cytokine signature. In fact, our data suggest that an

IOERT exclusive treatment using 23 Gy could kill cells in a single session freeing the tumor


35

microenvironment of immune molecules able to affect the cell survival/cell death balance,

metastasis and/or fibrosis induction and thus able to affect tumor outcome.

Conclusions

IR activates complex cross-linked intracellular pathways able to regulate inflammation, DNA

repair, and cell fate, as also recently described by our group (32, 8, 6, 24, 33). Here we describe the

cytokine signatures released in the conditioned media by human MCF10A mammary epithelial cell

lines, MCF7 and MDA-MB-231 BC cell lines after single high radiation doses (9 Gy and 23 Gy)

delivered by IOERT. Our results reveal that cytokine production is regulated in time-dependent,

high dose-independent and cell line-dependent manners. Thus, personalized protocols should be

required to obtain successful treatments.

References

1.Bernier J, Hall EJ, Giaccia A. Radiation oncology: a century of achievements. Nat Rev Cancer.

2004;4:737–47.

2. Formenti SC, Demaria S. Systemic effects of local radiotherapy. Lancet Oncol 2009;10:718-26.

3. Sologuren I, Rodríguez-Gallego C, Lara PC. Immune effects of high dose radiation treatment:

implications of ionizing radiation on the development of bystander and abscopal effects. Transl

Cancer Res 2014;3(1):18-31.

4. Bernier J, Viale G, Orecchia R, Ballardini B, Richetti A, Bronz L, et al. Partial irradiation of the

breast: Old challenges, new solutions. Breast 2006;15:466-75.

5. Offersen BV, Overgaard M, Kroman N, Overgaard J. Accelerated partial breast irradiation as

part of breast conserving therapy of early breast carcinoma: a systematic review. Radiother Oncol

2009;90:1-13.

6. Williams NR, Pigott KH, Brew-Graves C, Keshtgar MR. Intraoperative radiotherapy for breast

cancer. Gland Surg 2014;3(2):109-19.

7. Kraus-Tiefenbacher U, Bauer L, Scheda A, Schoeber C, Schaefer J, Steil V, et al. Intraoperative

radiotherapy (IOERT) is an option for patients with localized breast recurrences after previous

external-beam radiotherapy. BMC Cancer 2007;7:178.

8. Bravatà V, Minafra L, Russo G, Forte GI, Cammarata FP, Ripamonti M, et al. High dose

ionizing radiation regulates gene expression changes in MCF7 breast cancer cell line. Anticancer

Res 35:5, 2015.

9. Bravatà V. Controversial roles of methylenetetrahydrofolate reductase polymorphisms and folate

in breast cancer disease. Int J Food Sci Nutr 2015;66(1):43-9


36

10.Bravatà V, Cammarata FP, Forte G, Minafra L. “Omics” of HER2-positive breast cancer.

OMICS 2013;17:119-29.

11.Bravatà V, Stefano A, Cammarata FP, Minafra L, Russo G, Nicolosi S, et al. Genotyping

analysis and 18FDG uptake in breast cancer patients: a preliminary research. J Exp Clin Cancer Res

2013;32:23.

12.Minafra L, Norata R, Bravatà V, Viola M, Lupo C, Gelfi C, et al. Unmasking epithelial-

mesenchymal transition in a breast cancer primary culture: a study report. BMC Res Notes

2012;5:343.

13.Minafra L, Bravatà V, Forte GI, Cammarata FP, Gilardi MC, Messa C. Gene expression

profiling of epithelial-mesenchymal transition in primary breast cancer cell culture. Anticancer Res

2014;34:2173-83.

14.Orecchia R, Leonardo MC. Intraoperative radiation therapy: is it a standard now? Breast

2011;20:S111-5.

15.Wallner P, Arthur D, Bartelink H, Connolly J, Edmundson G, Giuliano A, et al. Workshop

Participants. Workshop on partial breast irradiation: state of the art and the science. J Natl Cancer

Inst 2004;96:175-184.

16.Minafra L, Bravatà V. Cell and molecular response to IORT treatment. Transl Cancer Res

2014;3(1):32-47.

17.Brigati C, Noonan DM, Albini A, Benelli R. Tumors and inflammatory infiltrates: friends or

foes? Clin Exp Metastasis. 2002;19:247–58.

18.Balkwill F, Mantovani A. Inflammation and cancer: back to Virchow? Lancet. 2001;357:539–

45.

19.Caruso C, Lio D, Cavallone L, Franceschi C. Aging, longevity, inflammation, and cancer. Ann

N Y Acad Sci. 2004;1028:1–13.

20.Grivennikov SI, Greten FR, Karin M. Immunity, inflammation, and cancer. Cell 2010;140:883-

99.

21.Lathers DM, Young MR. Increased aberrance of cytokine expression in plasma of patients with

more advanced squamous cell carcinoma of the head and neck. Cytokine 2004;25:220-8.

22.Desai S, Kumar A, Laskar S, Pandey BN. Cytokine profile of conditioned medium from human

tumor cell lines after acute and fractionated doses of gamma radiation and its effect on survival of

bystander tumor cells. Cytokine 2013;61(1):54-62.

23.Lacroix M, Leclercq G. Relevance of breast cancer cell lines as models for breast tumours: an

update. Breast Cancer Res Treat 2004;83(3):249-89.


37

24.Minafra L, Bravatà V, Russo G, Forte GI, Cammarata FP, Ripamonti M, et al. Gene Expression

Profiling of MCF10A Breast Epithelial Cells Exposed to IOERT. Anticancer Res 2015;35(6).

25.Becker KG, Hosack DA, Dennis G Jr, Lempicki RA, Bright TJ, Cheadle C, et al. PubMatrix: a

tool for multiplex literature mining. BMC Bioinformatics 2003;4:61.

26.Sun Y, Cheng MK, Griffiths TR, Mellon JK, Kai B, Kriajevska M, et al. Inhibition of STAT

signalling in bladder cancer by diindolylmethane: relevance to cell adhesion, migration and

proliferation. Curr Cancer Drug Targets. 2013;13(1):57–68.

27.Munro AJ. Bystander effects and their implications for clinical radiotherapy. J Radiol Prot.

2009;29:A133–42

28.Dent P, Yacoub A, Contessa J, Caron R, Amorino G, Valerie K, et al. Stress and radiation-

induced activation of multiple intracellular signaling pathways. Radiat Res. 2003;159:283–300.

29.Shen Y, Devgan G, Darnell Jr JE, Bromberg JF. Constitutively activated Stat3 protects

fibroblasts from serum withdrawal and UV-induced apoptosis and antagonizes the proapoptotic

effects of activated Stat1. Proc Natl Acad Sci U S A. 2001;98:1543–8.

30.Hao S, Baltimore D. The stability of mRNA influences the temporal order of the induction of

genes encoding inflammatory molecules. Nat Immunol. 2009;10:281–8.

31.Fujisaki K, Fujimoto H, Sangai T, Nagashima T, Sakakibara M, Shiina N, et al. Cancer-

mediated adipose reversion promotes cancer cell migration via IL-6 and MCP-1. Breast Cancer Res

Treat 2015;150(2):255-63.

32.Di Maggio FM, Minafra L, Forte GI, Cammarata FP, Lio D, Messa C et al. Portrait of

inflammatory response to ionizing radiation treatment. J Inflamm (Lond) 2015;12:14.


38

Breast cancer cell response to electron beam irradiation

Luigi Minafra1*, Francesco P.Cammarata1, Federica M Di Maggio1, Giorgio Russo1, Marilena

Ripamonti1, Cristina Messa1,2,3, Maria C Gilardi1,3,4 Giusi I Forte1 and Valentina Bravatà1



Abstract

Intraoperative electron radiation therapy (IOERT) is a therapeutic technique

which consists in administering a single high dose of ionizing radiation (IR)

immediately after surgical removal of tumor to destroy the residual cancer

cells that may be left in the tumor site. Despite the documented and great

impact of IOERT in breast cancer (BC) care, and the trend for dose

escalation, very limited data are available regarding cell and molecular

effects activated by IOERT or high-dose treatments. The aim of this study

was to analyze the MCF7 breast cancer cell line response in terms of cell

viability, morphology and DNA damage following high radiation doses in

order to select potential new biomarkers of radiosensitivity, as well as to

improve personalized radiotherapeutic treatments. In the MCF7 cells we

observed morphological and molecular traits typical of senescent phenotype

associated with cell proliferation arrest after treatments with 9 and 23 Gy

doses.



39

Introduction

The aim of radiotherapy (RT) is to achieve local tumour control, to kill selectively the tumor cells

without causing significant damage to the surrounding normal tissues. The radiosensitivity and

radioresistance of tumors and healthy tissue is the major clinical issue object of research in

radiobiology (1-2). Intraoperative electron radiation therapy (IOERT) differs from conventional RT

since a large dose of IR is employed in a single fraction directly to the tumor bed during cancer

surgery, either as an exclusive treatment of 21-23 Gy or as an advanced boost of 9-12 Gy. The use

of IOERT for breast cancer (BC) treatment has increased due to the development of the partial

breast irradiation (PBI) strategy with the intent of avoiding tumor recurrence. This segmental RT

replaces whole-breast irradiation and is based on the discovery that approximately 85% of local

relapses are localized to the same breast quadrant from which the primary tumor was removed (3-

6). Preliminary results of PBI with IOERT, both as a boost and as an exclusive treatment, seem to

be promising in terms of local disease control, however very few data have been collected about

long-term toxicity, as well as molecular stress mechanisms specifically induced by high-dose

treatments (7). Ionizing radiation (IR) is both a carcinogen and a therapeutic agent: exposure at low

doses, for example, can increase an individual risk of developing cancer, while sufficient high doses

can slow down or stop even tumor growth. IR, both as X-rays, mainly used in conventional external

beam RT, and high-energy electrons generated by linear accelerators in IOERT, cause cell injury to

both tumor and normal cells, producing a disequilibrium in the survival/cell death decision (8-9).

Increasing evidence suggests that different factors, including the type of radiation and dose, are

primarily important in radiation cell response, related also to the cell type. However, factors

establishing the specific cellular fate after IR exposure have not been clearly defined. In addition, it

has been shown that cell death induction is a very complex mechanism accounting for the different

effects of IR, and cell death modality is not unique in response to radiation in cancer and in normal

cells (10-11). A limited number of studies describe the molecular basis of IOERT effects, in

particular, BC cell response after high IR doses, such as those delivered during IOERT, therefore

this topic need to be explored (7,12). The aim of this study was to analyze the main cell effects

following RT with high dose in terms of cell viability, morphology and DNA damage in order to

select potential new biomarkers of radiosensitivity useful in BC care. Here we report cell response

of human breast carcinoma MCF7 cells following IOERT treatment with 9 and 23 Gy doses.


IOERT. The NOVAC7 (Sortina IOERT Technologies, Vicenza, Italy) IOERT system producing

electron beams of 4, 6, 8 and 10 MeV nominal energies was used to perform treatments at different


40

tissue depths. The beam collimation was performed through a set of polymethylmethacrylate

applicators: cylindrical tubes with a diameter ranging from 3 to 10 cm and face angle of 0°-45°. The

electron accelerator system was calibrated under reference conditions defined by the International

Atomic Energy Agency Technical Reports Series No. 398 “Adsorbed Dose Determination in

External Beam Radiotherapy” (13). The irradiation setup and the dose distribution were studied by

modeling electron and photon propagation with Monte Carlo methods, a flexible yet rigorous

approach to simulate electron and photon transport. The simulations were performed with the

GEANT4 toolkit (European Organization for Nuclear Research-CERN, Meyrin, Switzerland)

widely adopted by the Medical Physics community to support technical and clinical issues in RT.

For our purposes, we used the IOERT therapy application to simulate the beam collimation system

of the NOVAC7 from the electron exit window into air, passing through the applicator-collimator

system, down to the cell plate (14). Cell irradiations were conducted with two dose values, 9 Gy to

evaluate the IOERT treatment in the boost scheme and 23 Gy to study the exclusive modality to the

100% isodose and at a dose rate of 3.2 cGy/pulse.

Cell culture and clonogenic survival assay. The MCF7 human epithelial breast carcinoma cell line

was purchased from the American Type Culture Collection (Manassas, VA, USA) and cultured in

Dulbecco's Modified Eagle's medium supplemented with 10% Fetal bovine serum, and 1%

penicillin/streptomycin in solution at 37˚C in an incubator with 5% CO2. All cell culture media and

supplements were obtained from Invitrogen (Carlsbad, CA, USA). Cells were seeded in 100-mm

petri dishes or in 24-well plates 48 hours before treatments and were irradiated at subconfluence.

Clonogenic survival assay of MCF7 cells was performed according to the protocol published by

Franken et al. (15). Briefly, 24 hours after irradiation, treated MCF7 cells were seeded in triplicate

at a density of 200-1000 cells per well in a 6-well plate to assay the surviving fraction. Considering

the high doses delivered, the clonogenic assay was also performed plating up to 10×104 cells in

100-mm Petri dishes. As control (basal), untreated cells were seeded in the same conditions in order

to evaluate the plating efficiency. Colonies were allowed to grow under normal cell culture

conditions for two or three weeks and then were fixed and stained for 30 min with 6%



(Carl Zeiss, Göttingen, Germany). To evaluate the effect of cell radiation, cells throughout the

course of the assays were monitored for cell morphology and growth pattern by photographing five

random fields for each treatment under a phase-contrast microscope.


41

γ-H2AX immunofluorescence analysis.

Cells were grown on glass coverslips to reach 70% confluency before treatment. Control cells

(basal, i.e untreated) were seeded in parallel. After defined times, cells on glass coverslips were

fixed and permeabilized with cold methanol for 20 min, then washed in Phosphate buffered saline

and stored at 4°C until immunofluorescence analysis. PBS containing 2% bovine serum albumin

and 0.1% Triton X-100 was used for blocking (blocking buffer) and antibody incubation. For

γH2AX determination, Alexa Fluor 488 Mouse anti-H2AX(p-S139) (BD Pharmingen, San

Diego, CA) antibody was diluted 1:200 in blocking buffer. Cell nuclei were counterstained with

Hoechst 33342 (Life Technology, Carlsbad, CA). Gelvatol (Sigma-Aldrich, Saint Louis, MO, USA)

was used as mounting medium. The images were captured by a Nikon Eclipse 80i (Chiyoda, Tokyo,

Japan). γH2AX quantification was performed by ImageJ analysis software

(http://rsb.info.nih.gov/ij/).

Results

Clonogenicity and morphology analyses.

In order to evaluate MCF7 cell radiosensitivity in terms of reproductive capacity following

irradiation, we performed a clonogenic survival assay according to the method described by

Franken et al. (15). Twenty-four hours after 9 and 23 Gy RT, cells were seeded, maintained under

normal culture conditions and observed from two to three weeks later for the formation of colonies.

The results showed that 9 and 23 Gy exposure inhibited the growth and proliferation of MCF7 cells,

as their colony-forming ability was markedly impaired by IR and no colonies were observed

following either treatment (Figure 1A). To analyze high-dose radiation effects on cell morphology,

cells throughout the course of the clonogenic assays were monitored by photographing random

fields for each treatment under phase-contrast microscopy. MCF7 cell response in terms of

morphology, observed after irradiation with 9 Gy and 23 Gy, was similar. As shown in Figure 1B,

irradiated MCF7 cells displayed a large and flat cell shape, with evident macroscopic plasma

membrane and nuclear alterations. These radiation-induced changes become visible starting from 72

h post treatment and increased within one week. The total detachment of cells from the culture

substrate was observed progressively after two to three weeks. The cell traits observed suggest a

typical senescent phenotype, the so-called 'fried egg', which is generally sustained by SA-β-Gal

activity (16-17). To confirm the effect of IR on senescence induction, SA- β-Gal activity was

examined after three and seven days of treatment. The number of cells exhibiting senescence-

specific morphologies and that displayed SA-β-Gal activity gradually increased up to seven days in


42

a dose- dependent manner (data not shown). Collectively, these results indicate that 9 and 23 Gy IR

doses induced senescence phenotypes in MCF7 cells (18).

Fig.1 (A) Clonogenic survival assay and B) morphological evaluation 1, 2, 3 weeks post IOERTs in MCF7 cell line.

DNA damage response: γH2AX immunofluorescence analysis. It is well known that histone H2AX

is rapidly phosphorylated at serine 139 (γ-H2AX) following exposure to IR, with a consequent

focus formation as a sensitive early cell response to the presence of DNA double-strand breaks

(DSBs) (19). To determine the time course of the appearance of γ-H2AX foci upon RT of MCF7

cells, we carried out direct immunofluorescence analyses after 15 min, 0.5, 1, 3, 6 and 24 h of

exposure to 9 and 23 Gy IR doses. Figure 2 shows that the formation of γ-H2AX foci occurred

rapidly within 15 min after irradiation at both 9 and 23 Gy. The quantification of γ-H2AX spots

revealed that at 9 Gy the foci numbers gradually reduced, in particular after a recovery time of 6

and 24 h, but at 23 Gy, they remained quite high up to 24 h after irradiation (data not shown). These

results suggest that foci formation in MCF7 cells is rapid, with a dose-dependent increase following

exposure to RT.


43

Fig.2. Immunofluorescence analysis of γH2AX after 15 min, 6 and 24 hours exposure to 9 and 23 Gy IOERT doses in

MCF7 cell line. γH2AX foci (green); nuclei are counterstained with Hoechst (blue) (micrographs 20x).

Discussion

Despite the great interest of the scientific community regarding the clinical application of high-dose

treatments, and in particular of IOERT on various cancer types, a limited number of studies

describe the biological and molecular basis. In particular, response of BC cells induced by high IR

doses, such as those used during this type of RT, need to be further explored (7-8).

The aim of the present study was to highlight cell and molecular response following IOERT

treatment with 9 and 23 Gy doses (IOERT boost and exclusive, respectively) to human breast

adenocarcinoma MCF7 cell line. Although immortalized cell lines may present some limitations in

predicting in vivo responses in humans, they remain well-established models in biomedicine for

elucidating a complete understanding of cellular processes in cancer, including tumor response to

radiation therapy.

Firstly, we evaluated cell viability in terms of reproductive capacity by performing a clonogenic

survival assay and observed that 9 and 23 Gy doses inhibited growth and proliferation of MCF7

cells. The colony-forming ability was markedly impaired by these high IR doses and no colonies

were observed during two to three weeks after either treatment.


44

The exposure of cells to IR causes various types of damage, such as the creation of DNA DSBs. It

is well known that histone H2AX is rapidly phosphorylated (γ-H2AX) following exposure to IR,

forming discrete nuclear foci at sites of DSBs to trigger DNA repair mechanisms (19-20). Using

immunofluorescence techniques, we evaluated the time-course for the appearance of γ-H2AX foci

in MCF7 cells upon high-dose treatments and our data revealed that foci formation rapidly

increased in a dose-dependent manner. If not adequately repaired, DSBs lead to cell clonogenicity

loss via the generation of lethal chromosomal aberrations, the direct induction of apoptotic cell

death or of cellular senescence. Cellular senescence is an irreversible cell-cycle arrest, which limits

the proliferative capacity of cells exposed to a sublethal dose of DNA-damaging agents, including

IR, or oxidative stress. Recent data report that senescence may play a more significant role in the

primary mechanism underlying the loss of the self-renewal capacity in IR- or drug-treated cancer

cells (12,21). The cell traits observed in MCF7 cells post high-dose treatment, such as the so-called

'fried egg', suggest a typical senescent phenotype, also confirmed by s SA-γ-Gal activity (18,21).

Moreover, the number of cells exhibiting senescence-specific morphology gradually increased in a

dose- and time-dependent manner. On the other hand, the morphological observation of treated cells

showed no evidence of apoptosis induction and this was also confirmed at the molecular level.

Western blot analysis revealed the absence of PARP fragmentation, suggesting that the apoptotic

pathway did not seem to be activated. Some signals of stress and survival were early induced

following treatments, such as p-p38 MAPK, GRP78, HSP70, p-AKT and p-ERK1/2 kinases (18,

data not shown). Furthermore, the senescence observed together with the increase of p21 and

survivin protein expression and the reduction of c-MYC expression could contribute to cell

proliferation arrest in MCF7 cells after both treatments.

Conclusion

The high-dose treatments inhibited the growth and proliferation of MCF7 cells and the post-

irradiation cell traits showed a typical senescent phenotype, confirmed by senescence-SA-γ-Gal

activity which increased in a dose- and time-dependent manner. Foci formation, by activation of γ-

H2AX factor, in MCF7 cells is rapid, with a dose-dependent increase following exposure to RT.

The results of this study, in association with gene expression profiling data obtained by our group,

could provide new insights to understand molecular mechanisms induced in cancer cells after a

treatment with high levels of radiation, opening opportunities for the development of new strategies

that selectively enhance radiotherapy effect on tumors.


45

References

1.Hogle W.P. The state of the art in radiation therapy. Seminars in Oncology Nursing, Vol 22, No

4; 212–220, 2006.


3.Bernier J, Viale G, Orecchia R, Ballardini B, Richetti A, Bronz L, Franzetti-Pellanda A, Intra M,

Veronesi U: Partial irradiation of the breast: Old challenges, new solutions. Breast 15: 466-75,

2006.

4.Offersen BV, Overgaard M, Kroman N, Overgaard J: Accelerated partial breast irradiation as part

of breast conserving therapy of early breast carcinoma: a systematic review. Radiother Oncol 90: 1-

13, 2009.

5.Veronesi U, Orecchia R, Luini A, Galimberti V, Zurrida S, Intra M, Veronesi P, Arnone P,

Leonardi MC, Ciocca M, Lazzari R, Caldarella P, Rotmensz N, Sangalli C, Sances D, Maisonneuve

P: Intraoperative radiotherapy during breast conserving surgery: a study on 1,822 cases treated with

electrons. Breast Cancer Res Treat 124: 141-51, 2010.

6.Kraus-Tiefenbacher U, Bauer L, Scheda A, Schoeber C, Schaefer J, Steil V, Wenz F:

Intraoperative radiotherapy (IOERT) is an option for patients with localized breast recurrences after

previous external-beam radiotherapy. BMC Cancer 7: 178, 2007.

7.Minafra L and Bravatà V: Cell and molecular response to IORT treatment. Transl Cancer Res 3,

32-47, 2014.

8.Di Maggio FM, Minafra L, Forte GI, Cammarata FP, Lio D, Messa C, Gilardi MC, Bravatà V:

Portrait of inflammatory response to ionizing radiation treatment. Journal of Inflammation 12: 14,

2015.

9.West CM, Barnett GC: Genetics and genomics of radiotherapy toxicity: towards prediction.

Genome Med 3(8): 52, 2011.

10.Eriksson D, Stigbrand T: Radiation-induced cell death mechanisms. Tumour Biol 31: 363-72,

2010.

11.Surova O, Zhivotovsky B: Various modes of cell death induced by DNA damage. Oncogene 32:

3789-97, 2013.

12.Golden EB, Pellicciotta I, Demaria S, Barcellos-Hoff MH, Formenti SC: The convergence of

radiation and immunogenic cell death signaling pathways. Front Oncol 2: 88, 2012.

13.International Atomic Energy Agency: Adsorbed Dose Determination in External Beam

Radiotherapy. An International Code of Practice for Dosimetry Based on Standards of Absorbed

Dose to Water. Technical Reports Series No. 398, Vienna, 2000.


46

14.Russo G, Casarino C, Arnetta G, Candiano G, Stefano A, Alongi F, Borasi G, Messa C, Gilardi

MC: Dose distribution changes with shielding disc misalignments and wrong orientations in breast

IOERT: a Monte Carlo-GEANT4 and experimental study. J Appl Clin Med Phys 13: 3817, 2012.

15.Franken NAP, Rodermond HM, Stap J, Haveman J, van Bree C: Clonogenic assay of cells in

vitro. Nature Protocols 1: 2315-2319, 2006.

16.Panganiban RA, Snow AL, Day RM: Mechanisms of radiation toxicity in transformed and non-

transformed cells. Int J Mol Sci 4: 15931-58, 2013.

17.Jan M van Deursen: The role of senescent cells in ageing. Nature 509: 439-446, 2014.

18.Bravatà V, Minafra L, Russo G, Forte GI, Cammarata FP, Ripamonti M, Casarino C, Augello G,

Costantini F, Barbieri G, Messa C, Gilardi MC. High-dose Ionizing Radiation Regulates Gene

Expression Changes in the MCF7 Breast Cancer Cell Line. Anticancer Res 35 (5):2577-91, 2015.


preferentially in euchromatin after ionising-radiation. PLoS One 24;2(10):e1057, 2007.

20.Firsanov DV, Solovjeva LV, Svetlova MP. H2AX phosphorylation at the sites of DNA double-

strand breaks in cultivated mammalian cells and tissues. Clin Epigenet 2:283-297, 2011.

21.Rodier F, Campisi J. Four faces of cellular senescence. J Cell Biol 192(4):547-56, 2011.


47

Experimental assessment of the accuracy of genomic response to radiation treatment in

cancer cells

Valentina Bravatà1*, Francesco P Cammarata1, Giorgio Russo1, Marilena Ripamonti1, Cristina

Messa1,2,3, Maria C Gilardi1,3,4 Giusi Irma Forte1 and Luigi Minafra1



Abstract

Intraoperative electron radiation therapy (IOERT) is a therapeutic technique

which administers a single high dose of ionizing radiation immediately after

surgical tumor removal. IOERT induces a strong stress response: both tumor

and normal cells activating pro- and antiproliferative cell signaling

pathways. Following treatment, several genes and factors are differently

modulated, producing an imbalance in cell fate decision. However, the

contribution of these genes and pathways in conferring different cell

radiosensitivity and radioresistance needs to be further investigated, in

particular after high-dose treatments. Despite the documented and great

impact of IOERT in breast cancer care, and the trend for dose escalation,

very limited data are available regarding gene-expression profiles and cell

networks activated by IOERT or high-dose treatment. The aim of the study

was to analyze the main pathways activated following high radiation doses

in order to select for potential new biomarkers of radiosensitivity or

radioresistance, as well as to identify therapeutic targets useful in cancer

care. For this pourpose, we performed gene-expression profiling of the

MCF7 human breast carcinoma cell line after treatment with 9- and 23-Gy

doses (conventionally used during IOERT boost and exclusive treatments,

respectively) by cDNA microarrays. Real-Time Quantitative Reverse

Transcription PCR (qRT-PCR) experiments were performed to validate

candidate IOERT biomarkers. The analyses highlighted a transcriptome

dependent on the dose delivered and a number of specific key genes that


48

may be proposed as new markers of radiosensitivity. We believe that this

study could contribute to the understanding over the complex mechanisms

which regulate cell radiosensitivity and radioresistance in order to improve

personalized radiotherapeutic treatment.


Introduction

Breast cancer (BC) rather presents distinct subtypes associated with different clinical outcomes.

Understanding this heterogeneity is a key factor for the development of targeted preventative and

therapeutic interventions (1). Intraoperative radiation therapy (IORT) is a therapeutic technique

which consists of administering a single high dose of ionizing radiation (IR) immediately after

surgical removal of tumor to destroy the residual cancer cells that may be left in the tumor site.

Interest in IORT for BC has increased in the last few years thanks to the development of the partial

breast irradiation strategy with the aim of avoiding tumor recurrence. Intraoperative electron

radiation therapy (IOERT), using an electron linear accelerator, according to specific eligibility

criteria may be: exclusive with the provision of a single radiation dose of 21-23 Gy corresponding to

the administration of the entire sequence of a conventional adjuvant radiotherapy (RT), or an

anticipated boost of 9-12 Gy, followed by conventional external RT to guarantee for optimal

accuracy in dose delivery (2-3). Although preliminary results of partial breast irradiation with

IOERT, either as an anticipated boost or as exclusive treatment, seem be promising in terms of local

disease control, little information has been collected about the biological basis of the effects of

IOERT, in particular those regarding molecular stress mechanisms (4-5). IR treatments induce a

strong cellular stress response, which leads to an imbalance in survival versus cell death decisions

(6-7). Despite the great interest of the scientific community regarding the clinical application of IR

to various cancer types, a limited number of studies describe the molecular basis of IOERT effects.

In particular, gene-expression profiles of BC cells treated with high IR doses, such as those

delivered during IOERT, need to be explored (8-9). Herein we report the gene expression response

of human breast carcinoma MCF7 cells following IOERT treatment with 9 and 23 Gy doses.


49





applicators: cylindrical tubes with a diameter ranging from 3 to 10 cm and face angle of 0˚-45˚. The













Whole-genome cDNA microarray expression analysis. Gene expression profiling of MCF7 cells

treated with 9 and 23 Gy IR doses was performed. Twenty-four hours after each treatment, MCF7

cells were harvested, counted and the pellet stored immediately at −80˚C. Total RNA was extracted

from cells using Trizol and the RNeasy mini kit according to the manufacturer’s guidelines

(Invitrogen). RNA concentration and purity were determined spectrophotometrically using a

Nanodrop ND-1000 (Thermo Scientific Open Biosystems, Lafayette, CO, USA) and RNA integrity,

measured as RNA integrity number (RIN) values, was assessed using a Bioanalyzer 2100 (Agilent

Technologies, Santa Clara, CA, USA). Only samples with a maximum RIN of 10 were used for

further microarray analysis. Five hundred nanograms of total RNA were used for cRNA synthesis

and labeling according to the Agilent Two-Color Microarray-Based Gene Expression Analysis

protocol. Samples were labeled with Cy5 and Cy3 dye (Agilent Technologies). Fluorescent

complementary cRNA samples (825 ng) were then hybridized onto Whole Human Genome 4×44K

microarray (Agilent Technologies) GeneChips containing all known genes and transcripts of an

entire human genome. Six replicates were performed. Array hybridization was conducted for 17 h at

65˚C. Images were made with an Agilent’s DNA Microarray Scanner with Sure Scan high-

Resolution Technology (Agilent Technologies) and analyzed using Feature Extraction expression


50

software (Agilent Technologies) that found and placed microarray grids, rejected outlier pixels,

accurately determined feature intensities and ratios, flagged outlier features, and calculated

statistical confidences. Statistical data analysis, background correction, normalization and summary

of expression measures were conducted with GeneSpring GX 10.0.2 software (Agilent

Technologies). Data were filtered using a two-step procedure: first the entities were filtered based

on their flag values P (present) and M (marginal) and then filtered based on their signal intensity

values, this enables very low signal values or those that have reached saturation to be removed.

Statistically significant differences were computed by Student’s test and the significance level was

set at p<0.05. The false discovery rate (FDR) was used as a multiple test correction method.

Average gene expression values of experimental groups were compared (on log scale) by means of

a modified ANOVA (p<0.05). Genes were identified as being differentially expressed if they

showed a fold change (FC) of at least 1.5 with a p-value <0.05 compared to untreated MCF7 cells

used as reference sample. The data discussed in this publication have been deposited in the National

Center for Biotechnology Information Gene Expression Omnibus (12) and are accessible through

GEOSeries accession number

(http://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?token=qnstoiigtlkbvkt&acc=GSE63667).

Microarray data are available in compliance with Minimum Information About a Microarray

Experiment standards.

MetaCore network analyses. The gene-expression profile of MCF7 cells irradiated with 9 Gy and

23 Gy were also analyzed by pathway analysis using the network building tool MetaCore GeneGo

(Thomson Reuters, Philadelphia, PA, USA) consisting of millions of relationships between proteins

derived from publications on proteins and small molecules (including direct protein interaction,

transcriptional regulation, binding, enzyme-substrates, and other structural or functional

relationships). Results, i.e. maps of protein lists from the uploaded dataset, were then compared

with all the possible pathway maps for all the proteins in the database, and the p-value was

calculated based on the hypergeometric distribution probability test. The most representative

significantly changed networks were selected and analyzed.

Real-Time Quantitative Reverse Transcription PCR. Candidate genes for qRT-PCR analysis were

chosen based on the microarray results. One microgram of total RNA was reverse-transcribed into

cDNA with SuperScriptII reverse transcriptase according to the manufacturer’s specifications

(Invitrogen). One microliter of cDNA (50 ng RNA equivalent) was analyzed by real-time PCR (1

cycle 95˚C for 20 s and 40 cycles of 95˚C for 3 s and 60˚C for 30 s) in triplicate using a Fast 7500

Real-Time PCR System (Applied Biosystems, Carlsbad, CA). Amplification reactions were


51

performed in a 20 µl reaction volume containing 10 pmoles of each primer and the Fast SYBR

Green Master Mix according to the manufacturer’s specifications (Applied Biosystems). Reaction

specificity was controlled by post-amplification melting-curve analysis. The oligonucleotide

primers were selected with Primer3 software (13-14) and tested for their human specificity using

the NCBI database. Primer sequences (forward and reverse) used are listed in Table 1. Quantitative

data, normalized versus the rRNA for 18S gene, were analyzed by the average of triplicate cycle

threshold (Ct) according to the 2-∆∆ct method using SDS software (Applied Biosystems). The data

shown were generated from three independent experiments and the values are expressed as the

mean±SD relative to mRNA levels in the untreated MCF7 cells used as the control sample.

Gene symbol Forward primer 5'>3' Reverse primer 5'>3' Template size (base pairs)

ADAMTS9 tcgctccactgttcactgtc ctgttgagggctctctctgg 297

ADRB1 ctccttcttctgcgagctgt agcacttggggtcgttgtag 266 ADRB2 ctgctatgccaatgagacctg gtcttgagggctttgtgctc 272 C2CD2 ggccgttaatatccagcccaa aagacgtggatgttcctcacc 252

CACNB2 tcctatggttcggcagactc ttaccaatcgccctatccacc 286 Cav1 tctctacaccgttcccatcc tccaaatgccgtcaaaactgtg 219 CDC25C tctggccaaggaaagctcag cgacagtaaggcagccact 207

CDC42 cttctttgctgctgcttcctg ctgagcatcaggcaactcaag 224 CDKN1A/p21 cggcttcatgccagctactt tcaccctgcccaaccttaga 245 FAM49B gggacttcccaggagaaaag cagaagggtctgatggaagc 243

FAS tcagtacggagttggggaag caggccttccaagttctgag 207 Fos caacttcattcccacggtcac tcccttcggattctccttttct 259 FosB aacccaccctcatctcttcc acccttcgcttctcctcttc 265

H2AFX cgggcgtctgttctagtgttt agtgattcgcgtcttcttgttg 293 HIST1H4E acatccagggcattaccaagc agagtgcgtccctgtctctt 216 HIST2H2AB gagtacctgaccgcggaaatt aaagagcctttggggtgaatga 268

HIST2H2AC tgtctggtcgtggcaaacaag ctgttcagttcctcgtcgttg 286 HISTH1B gcattaagctgggcctcaaga gctcttcgccacctttttgac 273 HISTH4B gataacatccaaggcatcacca gaggccattggaagaaaactga 266

ITPR1 gatcctggaggcagtaacca ggacatcctctcccgaattga 226 Jun ccacgcaagagaagaaggac gaaaagtcgcggtcactcact 280 JunB cggcagctacttttctggtc cacgtggttcatcttgtgcag 261

LEF agcagactggtttgcagtgaat gatgacagttttgggcaaaggc 211 LMNB1 ccttcttcccgtgtgacagt cctcccattggttgatcctg 224 MMP9 gagaccggtgagctggata tacacgcgagtgaaggtgag 236

MOAP1 cgcctgtggtctggcatattt cctcctgaacatccttccaag 222 NFKB cagctggatgtgtgactgga gtgggggaaaaatctccaaa 136 NR3C1 actggctgtcgcttctcaatc tgctgaactcttggggttctc 289

NR4A3 tccgctcctcctacactctc tccatggtcagcttggtgtag 200 PLK1 tgccacctcagtgacatgct cagtgccgtcacgctctatg 265 SNAI1 gcgagctgcaggactctaat ggacagagtcccagatgagc 135

TGFB2 gaccccacatctcctgctaa taagctcaggaccctgctgt 268 TNF ctatctgggaggggtcttc ggttgagggtgtctgaagga 201


52

Table 1. Primer sequences used for Real-Time Quantitative Reverse Transcription PCR analyses of

MCF7 cells treated with 9 Gy and 23 Gy

Results

Overview of cDNA microarray gene expression. In this study, a Two-Color Microarray-Based Gene

Expression Analysis was conducted on MCF7 cells treated with 9 Gy, 23 Gy and on the untreated

MCF7 cells, used as a reference sample. Comparative differential gene expression analysis revealed

that 2346 genes in MCF7 cells irradiated with 9 Gy had expression levels significantly altered by

1.5-fold or greater compared to the untreated reference group of MCF7 cells: 1259 genes were

down-regulated and 1087 were up-regulated. Moreover, comparative differential gene expression

analysis revealed that 813 genes in MCF7 cells irradiated with 23 Gy had expression levels

significantly altered by 1.5-fold or greater compared to the untreated MCF7 cells: 346 genes were

down-regulated and 467 were up-regulated (Gene Expression Omnibus ID: GSE63667). Up- and

down-regulated transcripts were selected and grouped according to their involvement in specific

biological pathways using integrated pathway enrichment analysis with GeneGo MetaCore. Data

sets were loaded into Metacore software and the top enriched canonical metabolic pathways were

analyzed. The result of this mapping revealed the involvement of a set of factors controlling specific

networks such as negative regulation of cellular processes, inflammation, tissue degradation, cell-

cycle modulation, and chromatin modification in comparison with the reference sample. Candidate

genes were selected, validated and analyzed using the PubMatrix tool (15) (Table 2). This way, lists

of terms such as gene names can be assigned to a genetic, biological, or clinical relevance in a

flexible systematic fashion in order to test our assumptions.

Gene symbol

Ionizing Radiation

Radiation Cancer Breast Cancer

Apoptosis Inflammation DNA damage

DNA repair

ADAMTS9 0 1 21 1 5 4 0 2

ADRB1 2 20 133 7 90 62 6 1 ADRB2 9 50 348 23 110 222 12 4 C2CD2 0 0 0 0 0 0 0 0 CACNB2 0 1 4 1 2 2 0 0 Cav1 9 34 503 100 115 65 8 6 CDC25C 60 92 612 75 367 12 255 52 CDC42 19 49 1330 171 359 125 28 9 CDKN1A/p21

5 5 20 3 23 1 13 3

FAM49B 0 0 0 0 0 2 0 0 FAS 376 823 7401 624 15646 1731 1272 168 Fos 280 937 4327 445 1356 977 406 193 FosB 4 19 129 16 46 19 10 9 H2AFX 469 716 953 123 447 19 1300 786 HIST1H4E 0 0 0 0 0 0 0 0


53

HIST2H2AB

0 0 0 0 0 0 0 0

HIST2H2AC

0 0 0 0 0 0 0 0

HISTH1B 0 0 0 0 0 0 0 0 HISTH4B 0 0 0 0 0 0 0 0 ITPR1 6 11 68 2 49 5 2 0 Jun 11307 56905 263705 25505 29543 41202 9837 6466 JunB 19 46 454 28 162 81 19 12 LEF 8 34 596 70 145 35 18 17 LMNB1 0 4 12 1 3 0 3 2 MMP9 22 78 1297 204 394 502 32 17 MOAP1 0 0 8 2 19 2 2 1 NFKB 15 41 258 39 186 189 34 17 NR3C1 0 4 54 5 21 22 3 5 NR4A3 0 2 87 5 42 24 4 7 PLK1 25 57 693 64 254 12 149 52 SNAI1 1 5 149 43 14 4 1 1 TGFB2 13 37 448 66 185 182 14 14 TNF 767 1993 19816 1407 16881 31724 1556 258

Table 2. PubMatrix analysis of selected validated genes. This table shows the number of

manuscripts on selected genes and queries available on Pubmed tool.

Microarray validation experiments. Genes for validation were chosen based on two considerations:

i) factors known to be modulated by IR; and ii) lesser-known genes involved in cell response to

high radiation doses to be proposed as new molecular markers. In order to identify possible

documented relationships between microarray gene expression lists and some processes known to

be involved in cell response to IR treatment, we used the PubMatrix V2.1 tool. This way,

bibliographic relationships between differentially expressed genes and some selected queries such

as ionizing radiation, radiation, cancer, BC, apoptosis, inflammation, DNA damage and DNA repair

were analyzed. Moreover, based on the microarray data set, PubMatrix results and MetaCore

analyses, we chose 33 candidate genes, some of these were common to MCF7 cells treated with 9

Gy and with 23 Gy, and performed qRT-PCR validation experiments (Table 3 and 4). In MCF7

cells treated with 9 Gy, 22 selected genes were validated. Fifteen genes known to be involved in

positive regulation of gene expression, cell-cycle regulation and inflammation, namely: cell division

cycle 25C (CDC25C), nuclear factor of kappa light polypeptide gene enhancer in B-cells (NFKB),

transforming growth factor beta 2 (TGFB2), matrix metallopeptidase 9 (MMP9), adrenoceptor beta

2 (ADRB2), snail family zinc finger 1 (SNAI1), jun proto-oncogene (JUN), caveolin 1 (CAV1),

tumor necrosis factor (TNF), adrenoceptor beta 1 (ADRB1), nuclear receptor subfamily 4, group A,

member 3 (NR4A3), jun B proto-oncogene (JUNB), FBJ murine osteosarcoma viral oncogene

homolog B (FOSB), histone cluster 1, H4e (HIST1H4E), FBJ murine osteosarcoma viral oncogene


54

homolog (FOS), were found to be upregulated. Seven genes involved in modulation of apoptosis

and in cellular signaling processes, namely modulator of apoptosis 1 (MOAP1) and inositol 1,4,5-

trisphosphate receptor, type 1 (ITPR1) and also ADAM metallopeptidase with thrombospondin type

1 motif 9 (ADAMTS9), lymphoid enhancer-binding factor-1 (LEF-1), nuclear receptor subfamily 3,

group C, member 1 (NR3C1,) family with sequence similarity 49, member B (FAM49B) and lamin

B1 (LMNB1) were down-regulated. In MCF7 cells irradiated with 23 Gy, 17 selected genes were

validated. Nine genes involved in cell death were up regulated, namely Fas cell surface death

receptor (FAS), MOAP1, cyclin-dependent kinase inhibitor 1A (p21, Cip1) CDKN1A, FAM49B,

NR3C1, NR4A3, C2CD2, ADAMTS9 and calcium channel, voltage-dependent, beta 2 subunit

(CACNB2), while eight genes of the histone cluster and involved in cell-cycle activation (polo-like

kinase 1 (PLK1), histone cluster 1, H4e (HIST1H4E), HISTH1B, HISTH4B, HIST2H2AB,

HIST2H2AC, CDC42 and H2A histone family, member X (H2AFX)) were down regulated (Table

3 and 4).

MCF7 9Gy Gene symbol Gene ID Description Microarra

y fold change

qRT-PCR fold change

ADAMTS9 56999 ADAM metallopeptidase with thrombospondin type 1 motif, 9

-3,37 0,04

ADRB1 153 Adrenoceptor beta 1 3.63 7,3 ADRB2 154 Adrenoceptor beta 2 4.6 2,96 Cav1 857 Caveolin 1, caveolae protein, 22kDa 6.4 4,2 CDC25C 995 cell division cycle 25C 1,84 1,2 FAM49B 51571 family with sequence similarity 49, member B -3,13 0,4 Fos 2353 FBJ murine osteosarcoma viral oncogene homolog 1.84 19 FosB 2354 FBJ murine osteosarcoma viral oncogene homolog B 2.38 14 HIST1H4E 8367 histone cluster 1, H4e 2,61 15,9 ITPR1 3708 inositol 1,4,5-trisphosphate receptor, type 1 -3,62 0,29 Jun 3725 jun proto-oncogene 1.86 3,8 JunB 3726 jun B proto-oncogene 2.68 13,9 LEF 51176 lymphoid enhancer-binding factor 1 -3.11 0,19 LMNB1 4001 lamin B1 -2.26 0,53 MMP9 4318 matrix metallopeptidase 9 1,70 1,6 MOAP1 64112 modulator of apoptosis 1 -2,76 0,15 NR3C1 2908 nuclear receptor subfamily 3, group C, member 1

(glucocorticoid receptor) -2.28 0,3

NR4A3 8013 nuclear receptor subfamily 4, group A, member 3 2,65 7,5 SNAI1 6615 snail family zinc finger 1 1.72 3,6 TGFB2 7042 transforming growth factor, beta 2 12.26 1,5 TNF 7124 tumor necrosis factor 4.39 5,3 NFKB 4792 nuclear factor of kappa light polypeptide gene enhancer in

B-cells inhibitor, alpha 1,87 1,5

Table 3. Up- and down-regulated genes in MCF7 cells treated with 9 Gy.


55

MCF7 23Gy

Gene symbol Gene ID Description Microarray fold change

qRT-PCR fold change

ADAMTS9 56999 ADAM metallopeptidase with thrombospondin type 1 motif, 9

1,80 5,12

C2CD2 25966 C2 calcium-dependent domain containing 2 2,15 2,82

CACNB2 783 calcium channel, voltage-dependent, beta 2 subunit 2,33 22

CDC42 998 cell division cycle 42 -1,58 0,74

CDKN1A/p21 1026 cyclin-dependent kinase inhibitor 1 1,6 2,67

FAM49B 51571 family with sequence similarity 49, member B 2,24 1,5

FAS 355 Fas cell surface death receptor 2,42 2

H2AFX 3014 H2A histone family, member X -1,51 0,78

HIST1H4E 8367 histone cluster 1, H4e -2,04 0,19

HIST2H2AB 317772 histone cluster 2, H2ab -3,01 0,63

HIST2H2AC 8338 histone cluster 2, H2ac -2,31 0,67

HISTH1B 3009 histone cluster 1, H1b -3,52 0,25

HISTH4B 8366 histone cluster 1, H4b -4,52 0,62

MOAP1 64112 modulator of apoptosis 1 2,40 2,2

NR3C1 2908 nuclear receptor subfamily 3, group C, member 1 (glucocorticoid receptor)

2,19 2,8

NR4A3 8013 nuclear receptor subfamily 4, group A, member 3 2,24 4,1

PLK1 5347 polo-like kinase 1 -1,55 0,23

Table 4. Up- and down-regulated genes in MCF7 cells treated with 23 Gy.

Discussion

Despite the great interest of the scientific community regarding the clinical application of high-dose

treatments, and in particular of IOERT on various cancer types, a limited number of studies

describe its biological and molecular effects. In particular, gene-expression profiles of BC cells

induced by high IR doses, such as those used during this type of RT, need to be further explored (8-

9). The aim of the present study was to highlight gene expression response following IOERT

treatment with 9 and 23 Gy doses (IOERT boost and exclusive, respectively) to human breast

adenocarcinoma MCF7 cell line. Twenty four hours after treatment, the intracellular network

involved in cell response to high-dose treatment appeared to be dose-dependent. More precisely,

our results show that the magnitude of transcriptional variation, defined as the number of

differentially expressed genes, seemed to regulate cell fate decision in two different ways.

The gene-expression profile of MCF7 cells irradiated at 9 Gy showed the involvement of key

factors regulating gene transcription, cell cycle and inflammatory processes.

In MCF7 cells treated with 9 Gy, 22 selected genes were validated. The following 15 genes known

to be involved in positive regulation of gene expression, cell-cycle regulation and inflammation


56

were found to be upregulated: CDC25C, NFKB, TGFB2, MMP9, ADRB2, SNAI1, JUN, CAV1,

TNF, ADRB1, NR4A3, JUNB, FOSB, HIST1H4E, FOS. Otherwise, the following 7 genes

involved in modulation of apoptosis and in cellular signaling processes were down-regulated:

MOAP1, ITPR1, ADAMTS9, LEF-1, NR3C1, FAM49B and LMNB1.

Even if DNA represents the critical target of the biological effects of IR, the responses generated by

high IR doses are not solely dedicated to safe-guarding genomic integrity, but also concern the

activation of critical transcription factors such as NF-κB and activator protein 1 (AP1), both already

found to be up-regulated following 9-Gy treatment (16-17). NF-κB is able to induce radioresistance

by cell-cycle regulation, alterations in apoptosis and changes in the ability of cells to repair DNA

damage. It has recently become an important target in the therapy of several

chemoresistant/radioresistant types of cancer (18-20). AP1 is a heterodimeric transcription factor

composed of FOS- and JUN-related proteins (21). In turn, JUN, JUNB, FOS and FOSB genes were

up regulated after 9 Gy IR. In addition, our data confirm previous studies indicating that JUNB gene

is responsive to IR and is immediately induced after stimulation (22), revealing its important role in

the early cell response process against radiation. Moreover, considering that AP1 activates the

epithelial–mesenchymal transition marker SNAI1, overexpressed in MCF7 cells treated with 9 Gy

and also in a variety of human malignancies such as BC, we speculated an EMT involvement in cell

response to high IR doses (23-25). However, qRT-PCR assays for other EMT markers, such as

those described recently by our group (23-24), did not support this hypothesis (data not shown). In

order to study other lesser-known genes involved in cell response to high radiation doses for

proposal as new molecular markers, we evaluated ADRB1, ADRB2, LMNB1 and NR3C1,

deregulated after IR with 9 Gy. Validation experiments confirm their expression trend, thus further

study are needed to understand their role in gene expression response to IR

In MCF7 cells irradiated with 23 Gy, 17 selected genes were validated. Nine genes involved in cell

death were up regulated (FAS, MOAP1, p21, CDKN1A, FAM49B, NR3C1, NR4A3, C2CD2,

ADAMTS9 and CACNB2, while 8 genes of the histone cluster and involved in cell-cycle activation

were down regulated (PLK1, HIST1H4E, HISTH1B, HISTH4B, HIST2H2AB, HIST2H2AC,

CDC42 and H2AFX). More precisely, is well-known that in addition to DNA damage and

inhibition of DNA synthesis, IR induces down regulation of histone mRNA levels in mammalian

cells, through the G1 checkpoint pathway (26). IR-induced inhibition of histone gene transcription

depends on the p21 protein, which was found to up regulated in MCF7 cells treated with 23 Gy. In

line with this assumption data, the gene expression profile of MCF7 cells treated with 23 Gy,

revealed that a large number of histone genes were down-regulated. Six of them were validated,

confirming their massive down-regulation after a high dose of IR; to our knowledge, this is the first


57

time this has been described in BC cells (27). In addition, as proposed by Du et al., intracellular

calcium levels could play an important role in regulating IR-induced cellcycle arrest, possibly

mediating chromatin structure (28). In line with these assumptions, the following two calcium-

related genes, CACNB2 and C2CD2 were up-regulated, suggesting an increase of the calcium level

after IR. Moreover, in MCF7 cells treated with 23 Gy, cell-cycle arrest may be suggested by the

down regulation of its positive modulators such as PLK1, CDC42 and CDC25A, which were down-

regulated, and by the upregulation of CDKN1A/p21.

In summary, gene profiles after high-dose exposure to RT, and specifically after IOERT, can vary

extensively depending on the dose delivered. Both the high doses of IR used in our experiments

altered several genes and processes, providing the opportunity to explore molecular target-directed

interventions to enhance tumor response to RT.

Conclusions

The main goal of IOERT is to deprive cancer cells of their reproductive potential, forcing them to

undergo cell death. Despite the great interest of the scientific community regarding high-dose

clinical applications for various cancer types, only a limited number of studies describe the

biological and molecular basis of high-dose effects, and specifically after IOERT (29). In order to

highlight genes and cellular networks activated after high single-dose treatments, and to select

potential new biomarkers of radiosensitivity and radioresistance, we performed a gene expression

analysis using Microarray approaches. We described the involvement of known genes also related

to the effects of lower doses of IR and introduced novel ones able to activate molecular networks

that might contribute to guiding cell-fate decision (30). We trust that this study will contribute to the

exploration of molecular target-directed interventions in order to improve personalized IR

treatments for BC.

References

1. Rakha EA, El-Sayed ME, Reis-Filho JS, Ellis IO 2008, Expression profiling technology: its

contribution to our understanding of breast cancer. Histopathology 52(1):67-81.

2. Wallner P, Arthur D, Bartelink H Connolly J, Edmundson G, Giuliano A, Goldstein N, Hevezi J,

Julian T, Kuske R, Lichter A, McCormick B, Orecchia R, Pierce L, Powell S, Solin L, Vicini F,

Whelan T, Wong J and Coleman CN, Workshop Participants: Workshop on partial breast

irradiation: state of the art and the science. J Natl Cancer Inst 96: 175-184, 2004.

3. Smith BD, Arthur DW, Buchholz TA, Haffty BG, Hahn CA, Hardenbergh PH, Julian TB, Marks

LB, Todor DA, Vicini FA, Whelan TJ, White J, Wo JY and Harris JR: Accelerated partial breast


58

irradiation consensus statement from the American Society for Radiation Oncology (ASTRO). Int J

Radiat Oncol Biol Phys 74: 987-1001, 2009.

4. Veronesi U, Orecchia R, Luini A, Galimberti V, Zurrida S, Intra M, Veronesi P, Arnone P,

Leonardi MC, Ciocca M, Lazzari R, Caldarella P, Rotmensz N, Sangalli C, Sances D and

Maisonneuve P: Intraoperative radiotherapy during breast conserving surgery: a study on 1,822

cases treated with electrons. Breast Cancer Res Treat 124: 141-51, 2010.

5. Kraus-Tiefenbacher U, Bauer L, Scheda A, Schoeber C, Schaefer J, Steil V and Wenz F:

Intraoperative radiotherapy (IOERT) is an option for patients with localized breast recurrences after

previous external-beam radiotherapy. BMC Cancer 7: 178, 2007.

6. Lomax ME, Folkes LK and O’Neill P: Biological consequences of radiation-induced DNA

damage: relevance to radiotherapy. Clin Oncol (R Coll Radiol) 25: 578-85, 2013.

7. Multhoff G and Radons J: Radiation, inflammation, and immune responses in cancer. Front

Oncol 2: 58, 2012.

8. Xu QY, Gao Y, Liu Y, Yang WZ and Xu XY: Identification of differential gene expression

profiles of radioresistant lung cancer cell line established by fractionated ionizing radiation in vitro.

Chin Med J (Engl) 121: 1830-7, 2008.

9. Snyder AR, Morgan WF: Gene expression profiling after irradiation: clues to understanding

acute and persistent responses? Cancer Metastasis Rev 23: 259-68, 2004.




11.Russo G, Casarino C, Arnetta G, Candiano G, Stefano A, Alongi F, Borasi G, Messa C and

Gilardi MC: Dose distribution changes with shielding disc misalignments and wrong orientations in

breast IOERT: a Monte Carlo-GEANT4 and experimental study. J Appl Clin Med Phys 13: 3817,

2012.

12.Edgar R, Domrachev M and Lash AE: Gene Expression Omnibus: NCBI gene expression and

hybridization array data repository. Nucleic Acids Res 30: 207-210, 2002.

13.Rozen S and Skaletsky HJ: Primer3 on the WWW for general users and for biologist

programmers. In: Bioinformatics Methods and Protocols: Methods in Molecular Biology. Krawetz

S and Misener S (eds.). Humana Press, Totowa, NJ: 365-386, 2000.

14.Primer3 tool. http//fokker.wi.mit.edu/primer3.

15.Becker KG, Hosack DA, Dennis G Jr, Lempicki RA, Bright TJ, Cheadle C and Engel J:

PubMatrix: a tool for multiplex literature mining. BMC Bioinformatics 4: 61,2003.


59

16.Dent P, Yacoub A, Fisher PB, Hagan MP and Grant S: MAPK pathways in radiation responses.

Oncogene 22: 5885-96, 2003.

17.McBride WH, Iwamoto KS, Syljuasen R, Pervan M and Pajonk F: The role of the

ubiquitin/proteasome system in cellular responses to radiation. Oncogene 22: 5755-73, 2003.

18.Chen X, Shen B, Xia L, Khaletzkiy A, Chu D, Wong JY and Li JJ: Activation of nuclear factor

κB in radioresistance of TP53-inactive human keratinocytes. Cancer Res 62: 1213-21, 2002.

19.Starenki D, Namba H, Saenko V, Ohtsuru A and Yamashita S: Inhibition of nuclear factor-

kappaB cascade potentiates the effect of a combination treatment of anaplastic thyroid cancer cells.

J Clin Endocrinol Metab 89: 410-8, 2004.

20.Yamamoto Y and Gaynor RB: Therapeutic potential of inhibition of the NF-κB pathway in the

treatment of inflammation and cancer. J Clin Invest 107: 135-42, 2001.

21.Benkoussa M, Brand C, Delmotte MH, Formstecher P and Lefebvre P: Retinoic acid receptors

inhibit AP1 activation by regulating extracellular signal-regulated kinase and CBP recruitment to an

AP1-responsive promoter. Mol Cell Biol 22: 4522-34, 2002.

22.Kajanne R, Miettinen P, Tenhunen M, Leppä S: Transcription factor AP1 promotes growth and

radioresistance in prostate cancer cells. Int J Oncol 35: 1175-82, 2009.

23.Minafra L, Norata R, Bravatà V, Viola M, Lupo C, Gelfi C and Messa C: Unmasking epithelial–

mesenchymal transition in a breast cancer primary culture: a study report. BMC Res Notes 5: 343,

2012.

24.Minafra L, Bravatà V, Forte GI, Cammarata FP, Gilardi MC and Messa C: Gene expression

profiling of epithelial–mesenchymal transition in primary breast cancer cell culture. Anticancer Res

34: 2173-83, 2014.

25.Sun M, Guo X, Qian X, Wang H, Yang C, Brinkman KL, Serrano-Gonzalez M, Jope RS, Zhou

B, Engler DA, Zhan M, Wong ST, Fu L and Xu B.: Activation of the ATM-SNAIL pathway

promotes breast cancer metastasis. J Mol Cell Biol 4:304-15, 2012.

26.Su C, Gao G, Schneider S, Helt C, Weiss C, O'Reilly MA, Bohmann D and Zhao J: DNA

damage induces down regulation of histone gene expression through the G1 checkpoint pathway.

EMBO J 23: 1133-43, 2004.

27.Bird AW, Yu DY, Pray-Grant MG, Qiu Q, Harmon KE, Megee PC, Grant PA, Smith MM and

Christman MF: Acetylation of histone H4 by Esa1 is required for DNA double-strand break repair.

Nature 419: 411-5, 2002.

28.Du YC, Gu S, Zhou J, Wang T, Cai H, Macinnes MA, Bradbury EM and Chen X: The dynamic

alterations of H2AX complex during DNA repair detected by a proteomic approach reveal the


60

critical roles of Ca(2+)/calmodulin in the ionizing radiationinduced cell cycle arrest. Mol Cell

Proteomics 5: 1033-44, 2006.

29.Minafra L and Bravatà V: Cell and molecular response to IOERT treatment. Transl Cancer Res

3: 32-47, 2014.



Expression Changes in the MCF7 Breast Cancer Cell Line. Anticancer Res;35(5):2577-91, 2015.


61

Technical evaluation of the morphology and survival rates of cells exposed to ionizing

radiation

Valentina Bravatà1*, Francesco P Cammarata1, Giorgio Russo1, Marilena Ripamonti1, Cristina

Messa1,2,3, Maria C Gilardi1,3,4 Giusi I Forte1 and Luigi Minafra1



Abstract

The success of radiation therapy (RT) mainly depends on the total

administered dose. This must be homogeneously delivered to the tumor and

must preserve the surrounding healthy tissue. The radiobiology of the

healthy tissue response to ionizing radiation (IR) is a topic of interest that

needs more investigation to reducing the risks of secondary cancer.

Intraoperative electron radiation therapy (IOERT) is a therapeutic approach

that delivers a single high dose of ionizing radiation (IR) directly to the

tumor bed during cancer surgery. The main goal of IOERT is to counteract

tumor growth by acting on residual cancer cells as well as to preserve

healthy surrounding tissue from the side effects of RT. The purpose of this

study was to highlight cell and molecular responses following IOERT

treatment in the human non-tumorigenic mammary MCF10A cell line in

order evaluate the toxic effects of high dose delivery. We evaluated cell

viability in terms of clonogenic capacity, cell morphology and DNA

damage. Our results show consistent differences in non-tumorigenic cell

tolerance and in the molecular response of MCF10A cells to different

IOERTs.



62

Introduction

Radiation therapy (RT) is one of the most effective arms for cancer treatment. About 60% of cancer

patients receive RT as part of the management of their disease, often used in combination with

surgery and chemotherapy. The main goal of RT treatments is to achieve local tumour control, to

kill selectively cancer cells without causing significant damage to the surrounding normal tissues.

RT uses high energy ionizing radiation (IR) generated with conventional accelerators, such as X-

rays, γ-rays, charged particles, e.g electrons with high dose rate (1-3). Intraoperative electron

radiation therapy (IOERT) differs from conventional RT since a large dose of IR is employed in a

single fraction directly to the tumor bed during cancer surgery, either as an exclusive treatment of

21-23 Gy or as an advanced boost of 9-12 Gy. The use of IOERT for breast cancer (BC) treatment

is based on the partial breast irradiation (PBI) strategy with the intent of avoiding tumor recurrence

(4-7). IR cause cell injury to both tumor and normal cells, producing a producing an imbalance in

survival/cell death decision. However, factors establishing the specific cellular fate after IR

exposure have not been clearly defined (8-9). In addition, it has been shown that cell death

induction is a very complex mechanism accounting for the different effects of IR, and cell death

modality is not unique in response to radiation in cancer and in normal cells (10-11). Despite the

great interest of the scientific community about the clinical application of IOERT in BC, very few

studies describe the effects of IOERT and particularly the molecular mechanisms of radiation

toxicity in normal breast tissue (8). Therefore, non-tumorigenic breast cell effects after treatment

with high IR doses, such as those used during IOERT need to be further evaluated. It should also be

taken into account that BC is a heterogeneous and complex disease at both molecular and clinical

level. Thus, on the one hand, the failure of radiation treatments associated with cell radioresistance

may occur and on the other, effects due to radiosensitivity of the normal tissue surrounding the

tumor may be present (12-13). In order to assess the toxic effects of IOERT, we report cell and

molecular responses of the non-tumorigenic mammary MCF10A cell line, used as a model of

normal breast epithelial cells, following exposure to 9 and 23 Gy doses.





applicators: cylindrical tubes with a diameter ranging from 3 to 10 cm and face angle of 0°-45°. The




63











Cell culture and clonogenic survival assay. The human non-tumorigenic breast epithelial MCF10A

cell line was purchased from the American Type Culture Collection (Manassas, VA, USA) and

cultured at 37°C in an incubator with 5% CO2 according to the supplier's instructions. All cell

culture media and supplements were obtained from Invitrogen (Carlsbad, CA, USA). Cells were

seeded in 100-mm Petri dishes or in 24-well plates 48 hours before treatments and at sub-

confluence were irradiated.

Clonogenic survival assay of MCF10A cells was performed according to the protocol published by

Franken et al. (16). Briefly, 24 hours after irradiation, treated cells were seeded in triplicate at a

density of 200-1000 cells per well in a 6-well plate to assay the surviving fraction. Considering the

high doses delivered, the clonogenic assay was also performed plating up to 10×104 cells in 100-

mm Petri dishes. As control (basal), untreated cells were seeded in the same conditions in order to

evaluate the plating efficiency (PE). Colonies were allowed to grow under normal cell culture

conditions for two or three weeks and then were fixed and stained for 30 min with 6%



(Carl Zeiss, Göttingen, Germany). The surviving fraction (SF) of irradiated cells was normalized to

the PE of untreated control cells. Data represent the average SF ± standard deviation (SD) of three

biologically independent experiments. To evaluate the effect of cell radiation, cells throughout the

course of the assays were monitored for cell morphology and growth pattern by photographing five

random fields for each treatment under a phase-contrast microscope (Carl Zeiss, Göttingen,

Germany).


64

γ-H2AX immunofluorescence analysis.

Cells were grown on glass coverslips to reach 70% confluency before treatment. Control cells

(basal, i.e untreated) were seeded in parallel. After defined times, cells on glass coverslips were

fixed and permeabilized with cold methanol for 20 min, then washed in Phosphate buffered saline

and stored at 4°C until immunofluorescence analysis. PBS containing 2% bovine serum albumin

and 0.1% Triton X-100 was used for blocking (blocking buffer) and antibody incubation. For

γH2AX determination, Alexa Fluor 488 Mouse anti-H2AX(p-S139) (BD Pharmingen, San

Diego, CA) antibody was diluted 1:200 in blocking buffer. Cell nuclei were counterstained with

Hoechst 33342 (Life Technology, Carlsbad, CA). Gelvatol (Sigma-Aldrich, Saint Louis, MO, USA)

was used as mounting medium. The images were captured by a Nikon Eclipse 80i (Chiyoda, Tokyo,

Japan). γH2AX quantification was performed by ImageJ analysis software

(http://rsb.info.nih.gov/ij/).

Results

Clonogenicity and morphology analyses. In order to assess MCF10A cell viability in terms of

reproductive capacity after IOERT, clonogenic survival assays were performed. Twenty-four hours

post-irradiation with 9 and 23 Gy doses, cells were seeded appropriately, maintained under normal

culture conditions and analyzed from two to three weeks later for the formation of colonies. The

results showed that 23 Gy exposure inhibited the growth and proliferation of MCF10A cells, as

colony-forming ability was markedly impaired by irradiation and no colonies were observed. On the

contrary, following the 9 Gy boost treatment, an SF of 9.6% was found, indicating the selection of a

surviving radioresistant cell fraction with reproductive capacity (Figure 1A).

To evaluate the effects of IOERT on cell morphology, throughout the course of the clonogenic

assays, cells were observed under phase-contrast microscopy and random fields for each treatment

were photographed. After irradiation with 9 Gy and 23 Gy doses, the response of MCF10A cells in

terms of morphology was similar. Cell damage at both the membranous and cytoplasmic levels was

observed, starting 72 hours post treatments and increasing within one week. The total detachment of

MCF10A cells treated with 23 Gy from the culture substrate occurred progressively from two to

three weeks. In the case of MCF10A cells treated with 9 Gy, a radioresistant growing cell fraction,

which we maintained in culture up to three weeks post treatment, was also observed (Figure 1B).

Moreover, unlike IOERT-treated MCF7 cells (17), MCF10A cells did not exhibit morphology of a

radiation-induced senescent phenotype. Indeed, biochemical tests for senescence-associated-β-

galactosidase activity did not reveal any cellular senescence activation in response to IOERT (data

not shown).


65

Figure 1. (A) Clonogenic survival assay and B) morphological evaluation 1, 2, 3 weeks post IOERTs in MCF10A cell

line.

DNA damage response: γH2AX immunofluorescence analysis. Following exposure to IR, histone

H2AX is immediately phosphorylated at serine 139 (γ-H2AX) with consequent foci formation as a

sensitive early cell response to the presence of DNA double-strand breaks (18-19).

To evaluate the time course of the appearance of γ-H2AX foci in MCF10A cells upon IOERT, we

performed direct immunofluorescence analyses after 0.5, 1, 3, 6 and 24 hours of exposure to 9 and

23 Gy IR doses. γ-H2AX foci formation occurred within 30 minutes of irradiation at 9 and 23 Gy

doses. In particular, in MCF10A cells treated 9 Gy, the number of foci gradually decreased at 6 and

24 hours post-treatment, whereas in MCF10A cells treated with 23 Gy, it remained high with

respect to untreated cells at 24 hours after irradiation (Figure 2). These results suggest that foci

formation in MCF10A cells was rapid, with a dose-dependent increase following exposure to

IOERT.


66

Figure.2. Immunofluorescence analysis of γH2AX after 15 min, 6 and 24 hours exposure to 9 and 23 Gy IOERT doses

in MCF10A cells. γH2AX foci (green); nuclei are counterstained with Hoechst (blue) (micrographs 20x).

Discussion

Medical applications of high doses of charged particles, such as those used during IOERT, involve

the exposure of normal cells, tissues and organs proximal to the tumor. The radiobiology of healthy

cells and tissue response to IR is a topic of interest which may contribute to avoiding the

impairment of normal tissue and organ function and to reducing the risks of secondary cancer. To

date, very few articles have described the biological and molecular basis of IOERT effects (8,17).

The aim of this study was to analyze cell and molecular response following IOERT treatment with 9

and 23 Gy doses (IOERT boost and exclusive, respectively) in human non-tumorigenic MCF10A

mammary cell line as a model of normal breast epithelial cells. We assessed cell viability in terms

of reproductive capacity performing a clonogenic survival assay and observed that the 23 Gy

exposure inhibited the growth and proliferation of MCF10A cells. On the contrary, following the 9

Gy boost treatment, a surviving radioresistant cell fraction with reproductive capacity was found.

Immunofluorescence analyses showed that γ-H2AX foci formation rapidly increased in a dose-

dependent manner following both IOERT modalities, in MCF10A cells treated with 9 Gy, the

number of foci gradually decreased after-irradiation, whereas in cells treated with 23 Gy, it


67

remained high at 24 hours post treatment. Foci formation at sites of double-strand breaks reveals the

induction of DNA-repair mechanisms, however, if such damage is not adequately repaired it can

lead to cell clonogenicity loss via the generation of lethal chromosomal aberrations, apoptotic cell

death or cellular senescence (20,11). Unlike the senescent features that we described in MCF7 cells

following 9 and 23 Gy exposures (17), MCF10A cells did not show a radiation-induced senescent

phenotype, as displayed by morphological traits and by a lack of β-galactosidase activity (data not

shown). In addition, by western blot analysis, we did not observe induction of intrinsic apoptotic

response, as evidenced by the absence of PARP fragmentation. PARP protein levels remained

unchanged following both treatments. On the contrary, the extrinsic apoptotic pathway seemed to

be activated. Indeed, a time-dependent increase in FAS expression and a simultaneous decrease of

pro-caspase-8 expression was observed after both treatments in immunoblotting experiments (21,

data not shown).

Conclusion

Our results show consistent differences in non-tumorigenic cell tolerance and in the molecular

response of MCF10A cells to different IOERT treatments. In particular, after 9 Gy of exposure, the

selection of a radioresistant cell fraction was observed and the cells did not exhibit a radiation-

induced senescent phenotype. The possibility of clarifying the molecular strategies adopted by cells

in choosing between death or survival after IR-induced damage opens up new avenues for the

selection of a proper personalized therapy schedule and to reducing the risks of secondary cancer.

References

1.Yard B, Chie EK, Adams DJ, Peacock C, Abazeed ME. Radiotherapy in the Era of Precision

Medicine. Semin Radiat Oncol 25(4):227-36, 2015.

2.Hogle W.P. The state of the art in radiation therapy. Seminars in Oncology Nursing 22 (4): 212–

220, 2006.


4.Offersen BV, Overgaard M, Kroman N and Overgaard J: Accelerated partial breast irradiation as

part of breast conserving therapy of early breast carcinoma: a systematic review. Radiother Oncol

90: 1-13, 2009.

5.Smith BD, Arthur DW, Buchholz TA, Haffty BG, Hahn CA, Hardenbergh PH, Julian TB, Marks

LB, Todor DA, Vicini FA, Whelan TJ, White J, Wo JY and Harris JR: Accelerated partial breast

irradiation consensus statement from the American Society for Radiation Oncology (ASTRO). Int J

Radiat Oncol Biol Phys 74(4):987-1001, 2009.


68

6.Kraus-Tiefenbacher U, Bauer L, Scheda A, Schoeber C, Schaefer J, Steil V and Wenz F:

Intraoperative radiotherapy (IORT) is an option for patients with localized breast recurrences after

previous external-beam radiotherapy. BMC Cancer 14;7:178, 2007.

7.Veronesi U, Orecchia R, Luini A, Galimberti V, Zurrida S, Intra M, Veronesi P, Arnone P,

Leonardi MC, Ciocca M, Lazzari R, Caldarella P, Rotmensz N, Sangalli C, Sances D and

Maisonneuve P: Intraoperative radiotherapy during breast conserving surgery: a study on 1,822

cases treated with electrons. Breast Cancer Res Treat 124(1):141-51, 2010.

8.Minafra L and Bravatà V. Cell and molecular response to IORT treatment. Transl Cancer Res 3,

32-47, 2014.

9.Di Maggio FM, Minafra L, Forte GI, Cammarata FP, Lio D, Messa C, Gilardi MC, Bravatà V.

Portrait of inflammatory response to ionizing radiation treatment. Journal of Inflammation 12: 14,

2015.

10.Surova O, Zhivotovsky B: Various modes of cell death induced by DNA damage. Oncogene 32:

3789-97, 2013.

11.Golden EB, Pellicciotta I, Demaria S, Barcellos-Hoff MH, Formenti SC: The convergence of


12.Bravatà V, Cammarata FP, Forte GI and Minafra L: “Omics” of HER2-positive breast cancer.

OMICS 17:119-29, 2013.


mesenchymal transition in a breast cancer primary culture: a study report. BMC Res Notes 5:343,

2012.




15.Russo G, Casarino C, Arnetta G, Candiano G, Stefano A, Alongi F, Borasi G, Messa C, Gilardi

MC: Dose distribution changes with shielding disc misalignments and wrong orientations in breast

IOERT: a Monte Carlo-GEANT4 and experimental study. J Appl Clin Med Phys 13: 3817, 2012.

16.Franken NAP, Rodermond HM, Stap J, Haveman J, van Bree C: Clonogenic assay of cells in

vitro. Nature Protocols 1: 2315-2319, 2006.



Expression Changes in the MCF7 Breast Cancer Cell Line. Anticancer Res 35 (5):2577-91, 2015.


preferentially in euchromatin after ionising-radiation. PLoS One 24;2(10):e1057, 2007.


69

19.Firsanov DV, Solovjeva LV, Svetlova MP. H2AX phosphorylation at the sites of DNA double-

strand breaks in cultivated mammalian cells and tissues. Clin Epigenet 2:283-297, 2011.

20.Lomax ME, Folkes LK and O’Neill P: Biological consequences of radiation-induced DNA

damage: relevance to radiotherapy. Clin Oncol (R Coll Radiol) 25:578-85, 2013.

21.Minafra L, Bravatà V, Russo G, Forte GI, Cammarata FP, Ripamonti M, Candiano G, Cervello

M, Giallongo A, Perconti G, Messa C, Gilardi MC. Gene Expression Profiling of MCF10A Breast

Epithelial Cells Exposed to IOERT. Anticancer Res 35(6):3223-34, 2015.


70

Transcriptional changes radiation-induced in mammary cells

Luigi Minafra1*, Francesco P Cammarata1, Giorgio Russo1 Marilena Ripamonti1, Cristina

Messa1,2,3, Maria C Gilardi1,3,4 Giusi Irma Forte1 and Valentina Bravatà1



Abstract

The radiobiology of the healthy tissue response to IR is a topic of interest

which may contribute to avoiding impairment of normal tissue and organ

function and to reducing the risks of secondary cancer. The main goal of

Intraoperative electron radiation therapy (IOERT) is to counteract tumor

growth by acting on residual cancer cells as well as to preserve healthy

surrounding tissue from the side-effects of radiation therapy. The purpose of

the study was to highlight gene expression responses following IOERT

treatment in the human non tumorigenic MCF10A cell line in order to find

new potential biomarkers of radiosensitivity/radioresistance. Gene-expression

profiling of MCF10A cells treated with 9 and 23 Gy doses (IOERT boost and

exclusive treatment, respectively), was performed by whole genome cDNA

microarrays. Real-time quantitative reverse transcription (qRT-PCR)

analyses, were carried out to validate candidate IOERT biomarkers. The

study revealed a dose-dependent gene expression profile and specific key

genes that may be proposed as novel markers of radiosensitivity. The

possibility of clarifying the molecular strategies adopted by cells in response

to IR-induced damage opens-up new avenues for the selection of a proper

personalized therapy schedule.



71

Introduction

Intraoperative electron radiation therapy (IOERT) differs from conventional radiotherapy (RT),

since a large dose of ionizing radiation (IR) is employed in a single fraction directly to the tumor

bed during cancer surgery, either as an exclusive treatment of 21-23 Gy or as an advanced boost of

9-12 Gy. Recently, the use of IOERT for breast cancer (BC) treatment has increased due to the

intent of avoiding tumor recurrence. IR, both as X-rays, mainly used in conventional external-beam

RT, and high-energy electrons generated by linear accelerators in IOERT, cause cell injury to both

tumor and normal cells, producing a disequilibrium in the survival/cell death decision (1-3).

Bibliographic data suggest that different factors, such as the cell type, the type of radiation and

dose, are primarily important in molecular radiation response. However, factors establishing the

specific cellular fate after IR exposure have not been clearly defined. Several IR-induced genes

trigger complex intracellular signaling pathways controlling many processes, such as cell-cycle

progression, survival and cell death, DNA repair and inflammation (4-6). Despite the great interest

of the scientific community on the clinical application of IOERT in BC, very few studies describe

the effects of IOERT and particularly the molecular mechanisms of radiation toxicity in normal

breast tissue. More precisely, the gene-expression profiles of non-tumorigenic breast cells treated

with high IR doses, such as those used during IOERT need to be further evaluated (7-8). It should

also be taken into account that BC is a heterogeneous and complex disease at both molecular and

clinical levels. Thus, on the one hand, the failure of radiation treatments associated with cell

radioresistance may occur and on the other, effects due to radiosensitivity of the normal tissue

surrounding the tumor may be present (9-12). In order to assess the toxic effects of IOERT

treatment and to select for potential new biomarkers of radiosensitivity/radioresistance, we describe

the gene-expression response of the non-tumorigenic mammary MCF10A cell line, used as a model

of normal breast epithelial cells, following exposure to 9 and 23 Gy doses. Understanding the

molecular mechanisms of radiation toxicity is critical for the development of counter-measures for

radiation exposure, as well as for improvement of clinical radiation effects in cancer treatment.


IOERT treatment. The NOVAC7 (Sortina Iort Technologies, Vicenza, Italy) IOERT system was

used to perform treatments at different tissue depths. The beam collimation was performed through

a set of polymethylmethacrylate applicators: cylindrical tubes with a diameter ranging from 3 to 10

cm and face angle of 0˚-45˚. The electron accelerator system was calibrated under reference

conditions, cell irradiation setup and the dose distribution were conducted as previously reported


72

(13). IOERT cell treatments were carried out at two dose values, 9 Gy (in boost scheme) and 23 Gy

(according to the exclusive modality) to the 100% isodose at a dose rate of 3.2 cGy/pulse.

Whole-genome cDNA microarray expression analysis. Gene expression profiling of MCF10A cells

treated with 9 and 23 Gy IR doses were performed. Twenty-four hours after each treatment,

MCF10A cells were harvest, counted and the pellet stored immediately at -80˚C. RNA extraction,

quantification and purity evaluation were performed as previously described (13). Gene-expression

profiles of MCF10Acells treated with 9 Gy and 23 Gy were carried-out according to Agilent Two-

Color Microarray-Based Gene Expression Analysis protocol as described recently by our group

(13). Seven replicates were performed. Statistical data analysis, background correction,

normalization and summary of expression measure were conducted with GeneSpring GX 10.0.2

software (Agilent Technologies) as previously reported (13). Genes were identified as being

differentially expressed if they showed a fold-change (FC) of at least 1.5 and a pvalue for the

difference of less than 0.05 compared to untreated MCF10A cells used as reference sample. The

data discussed here have been deposited in Gene Expression Omnibus of National Center for

Biotechnology Information (NCBI) link (14) and are accessible through GEO Series accession

number (http://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE65954). Microarray data are

available in compliance with Minimum Information About a Microarray Experiment standards.

MetaCore network analyses. Gene expression profiles of IOERT treated MCF10A cells were also

analyzed by pathway analysis using the network building tool MetaCore (Thomson Reuters,

Philadelphia, PA, USA) consisting of millions of relationships between proteins derived from

publications about proteins and small molecules (including direct protein interaction, transcriptional

regulation, binding, enzyme-substrate, and other structural or functional relationships). Results, i.e.

maps of protein lists from the uploaded dataset, were then compared with all the possible pathway

maps for all the proteins in the database, and the p-value was calculated based on the

hypergeometric distribution probability test. The most representative networks that were

significantly changed were selected and analyzed.

Real-Time Quantitative Reverse Transcription PCR. Candidate genes for qRT-PCR analysis were

chosen based on the microarray results. One microgram of total RNA was reverse-transcribed into

cDNA and analyzed by real-time PCR as previously described (13). The oligonucleotide primers

were selected with Primer3 software (15-16) and tested for their human specificity using the NCBI

database. Primer sequences (forward and reverse) used are listed in Table 1. Quantitative data,


73

normalized versus 18S rRNA gene, were analyzed by the average of triplicate cycle thresholds (Ct)

according to the 2–∆∆ct method using SDS software (Applied Biosystems, Carlsbad, CA). The data

shown were generated from three independent experiments and the values are expressed relative to

mRNA levels in the untreated MCF10A cells used as control sample as the mean±SD.

Gene symbol Forward primer 5'>3' Reverse primer 5'>3' Template size (base pairs)

AURKA cccaccttcggcatcctaata tgactgaccacccaaaatctgc 279

PYGO atttgaagccttgcagcagactt ggagctttaccagcctccaat 246

KRT1 cgacctggacagcatcattg catccttgagggcattctcg 284

KRT16 tccagggactgattggcagt gaagacctcgcgggaagaat 209

CDC20 ctgtctgagtgccgtggat cgcagggtccaactcaaaac 262

CDC25C tctggccaaggaaagctcag cgacagtaaggcagccact 207

CENPF cgcattgaggccgatgaaaag ttcaggcttctggccatctc 218

PLK1 tgccacctccagtgacatgct cagtgccgtcacgctctat 265

GTSE1 acagattccaggctggtgga gcttgcagcatctggagtga 228

KIF2C acggagatccgtcaactcca tctcctcgctgaccatcct 230

MLL actcccccttccttcacct atccaccttgggtcccctta 299

ZDHHC15 tgcagggctcacagttacca ggtgccacaggaggtaatg 282

CXC gcatcagctttgaccgctac ggcatagcagtaggccatga 278

CASP8 ggctttgaccacgacctttg tatccccctgacaagcctga 287

CCNB1 caactgcaggccaaaatgcct cttcttctgcaggggcacat 259

CDKN1A/p21 cggcttcatgccagctactt tcaccctgcccaaccttaga 245

CDKN3 ttctgcaccagaggggaact caggctgtctatggcttgct 282

GADD45B ggctctctggctcggatttt acgctgtctgggtccacatt 239

HIST1H4B gataacatccaaggcatcacca ctgagaagggcctttgagga 266

HIST1H4C gtgctaagcgccatcgtaag ctgtgacagttttgcgcttgg 207

HIST1H4D gtcaagcgtatttctggcctc ccgttggttttgcggtagtgt 219

LMNB1 ccttcttcccgtgtgacagt cctcccattggttgatcctg 224

NDC80 ggtcgtgtcaggaaactgga aagtggtctcgggtcctga 293

NEK2 ccattggcacaggctccta agccagatcccctcctcca 248

NOTCH1 agctgcatccagaggcaaac tggttctggagggaccaaga 268

PLK1 tgccacctcagtgacatgct cagtgccgtcacgctctat 265

TP53INP tgctgagccatccactctga tccctgcatcaagccactac 232

Table 1. Primer sequences used for Real-Time Quantitative Reverse Transcription PCR analyses of

MCF10A cells treated with 9 Gy and 23 Gy

Results

Overview of cDNA microarray gene expression. In this study, a Two-Color Microarray-Based Gene

Expression Analysis (Agilent Technologies) was conducted on 9 Gy- and 23 Gy treated MCF10A

cells using untreated MCF10A cells as a reference sample. Comparative differential gene-

expression analysis revealed that in MCF10A cells treated with 9 Gy, expression levels of 72 genes


74

were significantly altered, by 1.5-fold or greater, compared to the untreated MCF10A cell reference

group: 18 genes were down-regulated and 54 were up-regulated. Moreover, comparative differential

gene expression analysis revealed that 451 genes in MCF10A cells treated with 23 Gy had

significantly altered expression levels specific biological pathways using integrated pathway

enrichment analysis with GeneGo MetaCore. Data sets were loaded into Metacore software and the

top enriched canonical metabolic pathways were analyzed. The result of this mapping revealed

involvement of a set of factors controlling specific networks such as regulation of cellular process,

inflammation, tissue degradation, cell-cycle modulation, and chromatin modification in comparison

to the reference sample. Candidate genes were selected, validated and analyzed using the PubMatrix

tool, as previously described (13, 17). compared to the untreated MCF10A reference group: 226

genes were down-regulated and 225 were up-regulated (GSE65954). Up- and down-regulated

transcripts were selected and grouped according to their involvement in specific biological

pathways using integrated pathway enrichment analysis with GeneGo MetaCore. Data sets were

loaded into Metacore software and the top enriched canonical metabolic pathways were analyzed.

The result of this mapping revealed involvement of a set of factors controlling specific networks

such as regulation of cellular process, inflammation, tissue degradation, cell-cycle modulation, and

chromatin modification in comparison to the reference sample. Candidate genes were selected,

validated and analyzed using the PubMatrix tool, as previously described (13, 17) .

Microarray validation experiments. Genes for microarray validation experiments were chosen

based on two considerations: i) factors known to be modulated by IR; and ii) less-known genes

involved in cell response to high radiation doses for proposal as new molecular markers. In order to

identify possible documented relationships between microarray gene-expression lists and processes

known to be involved in cell response to IR treatment, we used the PubMatrix V2.1 tool. In this

way, bibliographic relationships between differentially expressed genes and some selected queries

such as IR, radiation, cancer, BC, apoptosis, inflammation, DNA damage and DNA repair were

analyzed. Moreover, based on the microarray data set, the PubMatrix results and MetaCore

analyses, we chose 27 candidate genes and performed qRT-PCR validation experiments (Table 2

and Table 3). In MCF10A cells treated with 9 Gy, 13 selected genes were validated: 10 genes were

upregulated and among these, the following seven genes were described as being involved in the

positive regulation of the cell cycle and nuclear division: G2 and S-phase expressed 1 (GTSE1),

Aurora kinase A, transcript variant 1 (AURKA), Cell division cycle 20 (CDC20), CDC25C, PLK1,

Centromere protein F, 350/400kDa (mitosin) (CENPF) and Kinesin family member 2C (KIF2C)

(Table 2). As also shown in Table 2, the following three genes were down-regulated: Lysine (K)-


75

specific methyltransferase 2A (MLL), Chemokine (C-X-C motif) receptor 3 (CXCR3) and Zinc

finger, -type containing 15 (ZDHHC15). On the other hand, in MCF10A cells treated with 23 Gy,

14 selected genes were validated. As shown in Table 3, five genes were up-regulated: Caspase 8,

apoptosis-related cysteine peptidase (CASP8), Cyclin-dependent kinase inhibitor 1A (p21, CIP1)

(CDKN1A/p21), Growth arrest and DNAdamage- inducible, beta (GADD45B), Notch 1

(NOTCH1) and tumor protein p53 inducible nuclear protein 1 (TP53INP); while nine genes of the

histone cluster and involved in cell-cycle modulation, such as CCNB1, CDKN3, Histone cluster 1,

H4b (HIST1H4B), HIST1H4C, HIST1H4D, Lamin B1 (LMNB1), NDC80 kinetochore complex

component (NDC80), NIMArelated kinase 2 (NEK2) and PLK1, were down-regulated.

MCF10A 9Gy

Gene symbol Gene ID Description Microarray fold change

qRT-PCR fold change

AURKA 6790 Aurora kinase A (AURKA), transcript variant 1 1,66 1,4

CDC20 991 Cell division cycle 20 1,95 2,5

CDC25C 995 Cell division cycle 25 C 1,62 1,7

CENPF 1063 Centromere protein F, 350/400kDa (mitosin) 1,68 4,8

CXCR3 2833 Chemokine (C-X-C motif) receptor 3 (CXCR3) -5,02 0,62

GTSE1 51512 G-2 and S-phase expressed 1 2,00 1,3

KIF2C 11004 Kinesin family member 2C 1,69 1,7

KRT1 3848 Keratin 1 (KRT1) 1,70 2,6

KRT16 3868 Keratin 16 (KRT16) 1,54 1,3

MLL 4297 Lysine (K)-specific methyltransferase 2A -1,62 0,31

PLK1 5347 Polo-like kinase 1 1,92 9,9

PYGO 26108 Pygopus family PHD finger 1 6,03 1,3

ZDHHC15 158866 Zinc finger, DHHC-type containing 15 -3,32 0,16

Table 3. Up- and down-regulated genes in MCF10A cells treated with 9 Gy.

MCF10A 23Gy Gene symbol Gene ID Description Microarray

fold change qRT-PCR fold change

CASP8 841 Caspase 8, apoptosis-related cysteine peptidase 1,93 3,5

CCNB1 891 Cyclin B1 (CCNB1), mRNA [NM_031966] -1,96 0,59

CDKN1A/p21 1026 Cyclin-dependent kinase inhibitor 1A (p21, Cip1) 1,58 5,9

CDKN3 1033 Cyclin-dependent kinase inhibitor 3 -2,18 0,81

GADD45B 4616 Growth arrest and DNA-damage-inducible, beta 1,58 1,6

HIST1H4B 8366 Histone cluster 1, H4b -1,67 0,57

HIST1H4C 8364 Histone cluster 1, H4c -1,58 0,28

HIST1H4D 8360 Histone cluster 1, H4d -1,63 0,33

LMNB1 4001 Lamin B1 -1,70 0,7

NDC80 10403 NDC80 kinetochore complex component -1,98 0,43

NEK2 4751 NIMA-related kinase 2 -2,79 0,86


76

NOTCH1 4851 Notch 1 1,72 4,7

PLK1 5347 Polo-like kinase 1 -2,38 0,8

TP53INP 94241 Tumor protein p53 inducible nuclear protein 1 1,60 8,2

Table 3. Up- and down-regulated genes in MCF10A cells treated with 23 Gy.

Discussion

Medical applications of high doses of charged particles, such as those used during IOERT, involve

the exposure of normal cells, tissues and organs proximal to the tumor. Radiobiology of healthy

cells and tissue response to IR is a topic of interest which may contribute to avoiding the

impairment of normal tissue and organ function and to reducing risks of secondary cancer. To date,

few articles have described the biological and molecular basis of IOERT effects (13; 18-19). In

particular, gene-expression profiles of breast normal cells induced by high IR doses need to be

properly addressed. The purpose of the study was to analyze the gene expression response

following IOERT treatment with 9 and 23 Gy doses (IOERT boost and exclusive, respectively) in

human non-tumorigenic MCF10A mammary cell line as a model of normal breast epithelial cells.

To the best of our knowledge, no studies have examined the gene expression changes after high-

dose electron irradiation in MCF10A cells. Twenty four hour after treatments the cell networks

involved in IOERT response appeared to be dose-dependent. More precisely, our results revealed

that the magnitude of transcriptional variation, defined as the number of differentially expressed

genes, could drive two different cell fate decisions in a dose-dependent manner.

In MCF10A cells treated with 9 Gy, 13 selected genes were validated: 10 genes were up-regulated

and among these, the following seven genes were described as being involved in the positive

regulation of the cell cycle and nuclear division: GTSE1, AURKA, CDC20, CDC25C, PLK1,

CENPF and KIF2C (Table 2). As also shown in Table 3, the following three lesser known genes

were down-regulated: MLL, CXCR3 and ZDHHC15.

The gene expression profile of MCF10A cells treated with 9 Gy showed involvement of positive

cell-cycle modulators. IR is known to activate both pro- and anti-proliferative signal pathways,

producing an imbalance in the cell survival vs. death decision (2, 4). More precisely, MCF10A cells

treated with 9 Gy activate genes involved in cell-cycle regulation, as suggested by the up-regulation

of GSTE1, PLK1, AURKA, CDC25C, CDC20, CENPF and KIF2C genes. Overall, most of these

genes code proteins involved in spindle formation, centrosome maturation, mitotic processes, and

chromosome instability. Among these, we have focused particular attention on PLK1 gene that was

found over-expressed in MCF10A cells treated with 9 Gy. According to our hypothesis, this gene

may contribute to development of the surviving radioresistant cell fraction. More precisely, PLK1


77

represents a well-established factor that plays an important role in cell-cycle regulation, acting in

centrosome maturation, spindle formation, mitotic entry and cytokinesis (20-21). On the contrary,

PLK1 inhibition induces cell-cycle arrest, with subsequent cell death induction. It is interesting to

note that a pre-treatment with PLK1 inhibitors sensitized human medulloblastoma cells to IR (20),

thus down-regulation of the PLK1 gene observed in MCF10A cells treated with 23 Gy could

promote cell death (22-24). In summary, according to our hypothesis, in MCF10A cells treated with

9 Gy, the cell cycle appears to be positively modulated at the transcriptional level by several key

factors, which, to our knowledge, have never been described as being correlated to IR cell response.

Furthermore, we suggest that the selected up-regulated genes, such as those involved in mitotic

aberrations, should be further investigated in order to highlight their possible roles in the molecular

mechanisms of mammary carcinogenesis after IR exposure (25-28).

On the other hand, in MCF10A cells treated with 23 Gy, 14 selected genes were validated. As

shown in Table 3, five genes were up-regulated: CASP8, CDKN1A/p21, GADD45B, NOTCH1 and

TP53INP; while 9 genes of the histone cluster and involved in cell-cycle modulation, such as

CCNB1, CDKN3, HIST1H4B, HIST1H4C, HIST1H4D, LMNB1, NDC80, NEK2 and PLK1, were

down-regulated. Gene expression trend observed, could suggests the inhibition of the cell cycle

through down-regulation of its positive regulators, such as PLK1, NDC80, CDKN3, CCNB1 and

NEK2 genes. Overall, these genes have been described as regulators of late cell-cycle phases. As

recently reported, IR induces down-regulation of histone mRNA levels in mammalian cells (13, 29).

IR-induced inhibition of histone gene transcription depends on p21 protein expression, which was

up-regulated in MCF10A cells treated with 23 Gy. It has been reported that exposure to high- and

low-linear energy transfer radiation negatively regulates histone gene expression in human

lymphoblastoid and colon cancer cell lines (30). In line with these data, the gene-expression profile

of MCF10A cells treated with 23 Gy showed a large number of histone genes to be down-regulated.

Three of these were validated, confirming their down-regulation after a high dose of IR; to our

knowledge, this result is described for the first time in breast cells (13, 29). We also highlight the

involvement of well- and lesser-known genes related to the IR response, which are able to drive cell

fate in opposite ways. The coded proteins might activate a complex network that positively

regulates the cell cycle, promoting radioresistance in MCF10A cells treated with 9 Gy leading to a

surviving cell fraction, or inhibits cell-cycle progression in MCF10A cells treated with 23 Gy.

Considering their important roles in cell response to high radiation doses such as those used during

IOERT, we believe that the genes identified could act as prognostic indicators for RT.


78

Conclusions

The success of RT mainly depends on the total administered dose. This must be homogeneously

delivered to the tumor and must preserve the surrounding healthy tissue. The radiobiology of the

healthy tissue response to IR is a topic of interest that needs more investigation. High-throughput

methodologies, such as DNA microarray, allow the analysis of the mRNA expression of thousands

of genes simultaneously in order to discover new genes and pathways as targets of response to

IOERT. We observed consistent differences in transcription among the two treatments used and the

magnitude of transcriptional variation was dose-dependent (31). We highlighted novel genes able to

activate molecular networks contributing to guiding cell-fate decisions, which may provide the

opportunity to explore molecular target-directed interventions in the future.

References

1.Lomax ME, Folkes LK and O’Neill P: Biological consequences of radiation-induced DNA

damage: relevance to radiotherapy. Clin Oncol (R Coll Radiol) 25: 578-785, 2013.

2.Multhoff G and Radons J: Radiation, inflammation, and immune responses in cancer. Front Oncol

2: 58, 2012.

3.Eriksson D and Stigbrand T: Radiation-induced cell death mechanisms. Tumor Biol 31: 363-372,

2010.

4.Golden EB, Pellicciotta I, Demaria S, Barcellos-Hoff MH and Formenti SC: The convergence of


5.West CM and Barnett GC: Genetics and genomics of radiotherapy toxicity: towards prediction.

Genome Med 3(8): 52, 2011.

6.Xu QY, Gao Y, Liu Y, Yang WZ and Xu XY: Identification of differential gene expression

profiles of radioresistant lung cancer cell line established by fractionated ionizing radiation in vitro.

Chin Med J (Engl) 121: 1830-1837, 2008.

7.Snyder AR and Morgan WF: Gene expression profiling after irradiation: clues to understanding

acute and persistent responses? Cancer Metastasis Rev 23: 259-268, 2004.

8.Minafra L and Bravatà V: Cell and molecular response to IORT treatment. Transl Cancer Res

3(1): 32-47, 2014. doi:10.3978/j.issn.2218-676X.2014.02.03.

9.Bravatà V, Cammarata FP, Forte GI and Minafra L: “Omics” of HER2-positive breast cancer.

OMICS 17: 119-129, 2013.


79

10.Bravatà V, Stefano A, Cammarata FP, Minafra L, Russo G, Nicolosi S, Pulizzi S, Gelfi C,

Gilardi MC and Messa C: Genotyping analysis and 18F-FDG uptake in breast cancer patients: a

preliminary research. J Exp Clin Cancer Res 32: 23, 2013.


mesenchymal transition in a breast cancer primary culture: a study report. BMC Res Notes 5:343,

2012.

12.Minafra L, Bravatà V, Forte GI, Cammarata FP, Gilardi MC and Messa C: Gene expression

profiling of epithelial–mesenchymal transition in primary breast cancer cell culture. Anticancer Res

34(5): 2173-2183, 2014.



Expression Changes in the MCF7 Breast Cancer Cell Line. Anticancer Res;35(5):2577-91, 2015.

14.Edgar R, Domrachev M and Lash AE: Gene Expression Omnibus: NCBI gene expression and

hybridization array data repository. Nucleic Acids Res 30(1): 207-210, 2002.

15.Rozen S and Skaletsky HJ: Primer3 on the WWW for general users and for biologist

programmers. In: Bioinformatics Methods and Protocols: Methods in Molecular Biology. Krawetz

S and Misener S (eds.). Humana Press, Totowa, NJ, pp. 365-386, 2000.

16.Primer3 tool. http//fokker.wi.mit.edu/primer3.

17.Becker KG, Hosack DA, Dennis G Jr., Lempicki RA, Bright TJ, Cheadle C and Engel J:

PubMatrix: a tool for multiplex literature mining. BMC Bioinformatics 10: 4: 61, 2003.

18.Di Maggio FM, Minafra L, Forte GI, Cammarata FP, Lio D, Messa C, Gilardi MC and Bravatà

V: Portrait of inflammatory response to ionizing radiation treatment. J Inflamm 12: 14, 2015.

19.Herskind C and Wenz F: Radiobiological aspects of intraoperative tumour-bed irradiation with

low-energy X-rays (LEX-IORT). Transl Cancer Res 3: 3-17, 2014.

20.Harris PS, Venkataraman S, Alimova I, Birks DK, Donson AM, Knipstein J, Dubuc A, Taylor

MD, Handler MH, Foreman NK and Vibhakar R: Polo-like kinase 1 (PLK1) inhibition suppresses

cell growth and enhances radiation sensitivity in medulloblastoma cells. BMC Cancer 12: 80, 2012.

21.Strebhardt K: Multifaceted polo-like kinases: drug targets and antitargets for cancer therapy. Nat

Rev Drug Discov 9(8): 643-660, 2010.

22.Bièche I, Vacher S, Lallemand F, Tozlu-Kara S, Bennani H, Beuzelin M, Driouch K, Rouleau E,

Lerebours F, Ripoche H, Cizeron-Clairac G, Spyratos F and Lidereau R: Expression analysis of

mitotic spindle checkpoint genes in breast carcinoma: role of NDC80/HEC1 in early breast

tumorigenicity, and a twogene signature for aneuploidy. Mol Cancer 10: 23, 2011.


80

23.Korkola JE, Blaveri E, DeVries S, Moore DH, Hwang ES, Chen YY, Estep AL, Chew KL,

Jensen RH and Waldman FM: Identification of a robust gene signature that predicts breast cancer

outcome in independent data sets. BMC Cancer 7: 61, 2007.

24.Morris SR and Carey LA: Gene-expression profiling in breast cancer. Curr Opin Oncol 19: 547-

551, 2007.

25.Olson JE, Wang X, Pankratz VS, Fredericksen ZS, Vachon CM, Vierkant RA, Cerhan JR and

Couch FJ: Centrosome-related genes, genetic variation, and risk of breast cancer. Breast Cancer Res

Treat 125(1): 221-228, 2011.

26.D’Assoro AB, Lingle WL and Salisbury JL: Centrosome amplification and the development of

cancer. Oncogene 21(40): 6146-6153, 2002.

27.Brinkley BR: Managing the centrosome numbers game: from chaos to stability in cancer cell

division. Trends Cell Biol 11(1): 18-21, 2001.

28.Marx J: Cell biology: Do centrosome abnormalities lead to cancer? Science 292(5516): 426-429,

2001.

29.Su C, Gao G, Schneider S, Helt C, Weiss C, O'Reilly MA, Bohmann D and Zhao J: DNA

damage induces down regulation of histone gene expression through the G1 checkpoint pathway.

EMBO J 23(5): 1133-1143, 2004.

30.Meador JA, Ghandhi SA and Amundson SA: p53-independent down-regulation of histone gene

expression in human cell lines by high- and low-let radiation. Radiat Res 175(6): 689-699, 2011.

31.Minafra L, Bravatà V, Russo G, Forte GI, Cammarata FP, Ripamonti M, Candiano G, Cervello

M, Giallongo A, Perconti G, Messa C, Gilardi MC. Gene Expression Profiling of MCF10A Breast

Epithelial Cells Exposed to IOERT. Anticancer Res;35(6):3223-34, 2015.


81

A quality assurance setup for ultrasounds in vitro experiments.

Francesco P Cammarata1, Valentina Bravatà1, Luigi Minafra1, Fabrizio Vicari1, Giorgio Russo1,

Roberta Cirincione1, Cristina Messa1,2,3, Maria C Gilardi1,3,4 and Giusi Irma Forte1*



Abstract

In few decades, the technical steps forward accomplished into the acoustic

signal transduction and control fields, have brought to the safe release of a

large amount of acoustic energy in the body. Ultrasounds are extensively

used in medicine both for diagnostic imaging and for noninvasive therapies.

Today, the High Intensity Focused Ultrasound (HIFU) machines are able to

induce tissue's necrotic thermocoagulation in the Region Of Interest (ROI)

without the need of any invasive procedure, simply setting the physical

parameters modulating the acoustic beam, like the phase of the elements of

the transduction array. Even if HIFU in vitro experimentation are still an

open field, there is a lack of an accurate control of ultrasound for the non

linearity of the response that could lead to inconclusive or discordant

results. We approached the question suggested by the clinical practice,

where a Daily Quality Assurance (DQA) is required in order to execute a

treatment. In the following technical report, we report the practice that we

established to declare our system efficiency before in vitro experiments

starting.



82

Introduction

Their High-Intensity and Focused version are recently emerging as a promising weapon for solid

tumors treatment (1). Therapeutic strategies are based on the capability of acoustic waves to interact

with biological soft tissues through thermal and non-thermal physical mechanisms, to produce a

wide range of bioeffects. Indeed, when the acoustic waves interact with cell or tissue, they cause a

temperature (T) increase due to the conversion of acoustic energy into heat. The power of the

bioeffects generated, is related to the total acoustic power delivered and the duration of the exposure

that are able to produce different Ts and outcomes. For examples, in the diagnostic medical

sonography treatments, low-power and low-duration acoustic applications were provided. In this

sense, wave absorption is limited and the T rise is well below 2-3 °C (2). Even if this rise is mild, it

must be evaluated in some clinical applications such as the pre-natal ecography where the fetus T

should not safely rise more than 0.5°C above its normal value (3). Indeed, even if there are no data

regarding a robust relation between birth defects and in utero ultrasound (US) exposure, a link

between brain malformations and US exposure longer than 30 minutes in mice is been demonstrated

(4). Other clinical applications such as those related to tissue thermal ablation, use higher T in the

range of hyperthermia (40 - 43°C). The efficacy of treatment is related to the duration the exposure

and to the cellular types (5-6). Nowadays the clinical application of the High Intensity Focused

Ultrasound (HIFU) is limited to few procedures, based on the employment of the thermal effects.

Among these, the treatment of uterine fibroids, by the Magnetic Resonance guided Focused

Ultrasound Surgery (MRgFUS) ExAblate 2000 (InSightec Ltd, Tirat Carmel, Israel), received in

2004 the FDA approval (7). To date, other treatments base on HIFU systems guided by both

magnetic resonance and ultrasounds were developed. For examples, the palliative treatment of bone

metastasis, tremor, breast and prostate cancer are employed in Europe (8-11).

Regarding the non-thermal ultrasounds mechanisms generated, much more work is required to

push on their clinical employment for therapy applications. Large part of these mechanisms could

be referred to mechanical effects, such as radiation force, radiation torque and acoustic streaming

which act as physical forces applied on tissues (2). One of the most relevant non-thermal effect is

the cavitation, described as the formation, growth, oscillation and collapse of gaseous microbubbles

within tissues (12). During the cavitation process, the negative pressure peak cause the conversion

of water and volatile substances from liquid state to gas one depending on ultrasounds amplitude

and frequency (13). Thus, the gas bubbles generated oscillate around a neutral position, expanding

and rarefacting their volume in an harmonic way. More precisely, during a low intensity regime, the

phenomenon is almost stable, and could generate some micro-streaming that induces small sized

pores into the cell's plasma membrane (14). Otherwise, the increasing energy can turn cavitation


83

into unstable process, making bubbles collapse with the generation of a powerful micro-jet that can

damage permanently the lipid membrane and could causes the complete tissue disruption (15-16).

For the above mentioned reasons depending of the type of treatments to choose, is possible to avoid

the cavitation process or otherwise to use this phenomenon as an advantage, for example during an

ablation solid tumor treatment in order to destroy cells. In addition is also possible to modulate

cavitation using its non disruptive potential and relative non-thermal bioeffect generated in specific

treatment modalities. In this sense, the Ultrasound mediated Targeted Drug Delivery (UmTDD) and

SonoDynamic Therapy (SDT) are two of the novel promising therapeutic applications of Focused

UltraSound (FUS), employing mechanical effects (17-18). Moreover, biological studies have been

carried out and there are encouraging evidences to suggest that FUS exposure is a powerful

stimulus to induce stress response and apoptosis with minimal lysis in several cancer cell lines (19-

22).

Interestingly, US irradiation of cancer cell lines in conjunction with hyperthermia, photodynamic

therapy, radiotherapy and chemotherapy produces a synergistic effect to cell death in vitro,

described as the overall decrease in number of viable cells and inhibition of cancer cell proliferation

(23-27). In order to investigate the potential of ultrasounds in these applications, in vitro researches

are essential, to identify and better understand molecular mechanisms induced within cells and

tissues. To analyze molecular and cellular mechanisms induced by US treatment during in vitro

experiment, and to compare the relative results from studies, a stable and reproducible irrradiation

set-up model must be performed. In order to obtain repeatable and precise results an accurate

ultrasound characterization and control is needed, like it is done in the clinical field, where a Daily

Quality Assurance (DQA) is a routine for the HIFU applications (28-29). In this sense, the acoustic

characterization, the averaged (in space, time and both of them) intensity (W/cm2) or the pressure

field (MPa), the kind and nature of cells' grown supports and other technical features must be

defined. Our belief is that, if the role of a physical variables of interest were investigated, the

capability of the apparatus to control it, should be checked before every session. In this technical

report we will show the tests that we have carried out in order to obtain useful data from our in vitro

researches, considering that our first aim was focused on the power delivered and the focus position

in the space.


Focused Ultrasound System. Ultrasounds experiments were conducted using the the InSightec

ExAblate 2100 (InSightec Ltd, Tirat Carmel, Israel) MRgFUS equipment (30). It incorporates a 208

elements phased array transducer which can operate with a frequency that varies from 0,9 to 1,3


84

MHz and an energy from 100 to 6000 J. This transducer has 5 degrees of freedom in the space: it

can be elevated (Z), moved in the horizontal plane (XY) and rotated around the two axes that form

this plane (roll and pitch angles). The transducer can be moved through its axis thanks to CGA –

CSA. 4.75.24.(00) software (figure 1).

Figure 1. The transducer (left) can be moved acting on CGA – CSA. 4.75.24.(00) software

interface (right).

To assess the ranges commonly used in “low intensity” in vitro experiments, a continuous impulse

with 1 MHz frequency, 20 s duration and a variable intensity (< 10 W/cm2) was delivered (31).

Below, we have characterized the radiation force. The software used (Fiure 1), gives the possibility

to monitor the reflection (figure 2) in the hypersonic field giving a single pulse of desired power

before the requested sonication. This feature reduces the probability of damaging the transducer,

and gives the possibility to monitor the distance of the objects receiving the acoustic energy. Spot

position in the space is one of the relevant variables that has been investigated too.

Figure 2. Test of the plate's distance from the transducer by energy reflection


85

Radiation force and weighing system. Ultrasounds are the result of a mechanical perturbation of an

elastic and continuous a medium such as air or water. This perturbation generates the travel of a

pressure wave that runs from the emitter to the receiver. Real bodies are not perfect emitter and

their vibration produces not just a single traveling plane wave, but a field to which, every single

object within is subjected. This pressure is said “radiating” (pRad N/cm2) and the integration of its

value all across a surface is the Radiation Force FRad.

F Rad = ∫S

pRad (S )dS [N ]

It is difficult to obtain a complete understanding of this pressure field, pRad(S), but it is possible to

apply a simplification when the following two data are known: the total acoustic power output

(Wac) and the speed of the sound (c) in the medium in which is submerged

F Rad = W ac/c [N ]

This expression is reliable for high absorbing (α ≈ 1), low reflecting bodies (2). A correct estimation

of the radiation force means a correct evaluation of transducer power and then of the intensity

brought to the target spot. An easy and cheap way to measure radiation force indirectly is made by

the acquisition of the apparent weight reduction of an high absorbing target. This reduction is the

result of the difference between the real weight force of the target and the radiation force of the

hypersonic beam, supposed to act in opposition into the vertical direction. For this purpose we

employed a high precision (0,01 g) digital scale for generic purpose. The scale was placed over the

top of a water phantom, with its weighing plate firmly linked to the guides of the acoustic target

(data not shown). An external command was added to avoid the perturbations of the system caused

by the movement induced by cyclic tare procedures. Then an acrylic-glass support for the MR

pelvic coil was put around the weighing system to shield it from the environmental perturbations

(data not shown).

3D Modeling. To overcome the deficit of an ultrasounds guide and predict beams path, we have

developed the 3D model shown in figure 3. The model reproduces the essential parts of the

ExAblate 2100 in the in vitro configuration. The coupling and positioning system for culture plates,

supplied by InSightec, were also represented. It has a water phantom with two plastic rings

specially carved to house the standards culture plates and keep them in a fixed position in the space.


86

Figure 3. 3D model of the InSightec support for culture plates. In yellow the hypothetic

interceptions of the hypersonic cones with the support.

Gel Phantom Targets. According to the procedure described by Lafon C et al (32), a transparent

polyacrylamide hydrogel supplemented with bovine serum albumin (BSA) has been realized. This

phantom was made to be optically transparent at room temperature. Otherwise, thanks to protein

denaturation of BSA protein, it becomes opaque once overheated. In order to verify the geometrical

accuracy of our automatic system, we filled with this gel some of the 96 wells of a special plate

with a membrane at the bottom (Gas Permeable Plates. Coy Laboratory Products, Grass Lake, MI,

United States).

Custom Software. Geometrical calibration is an iterative process. When the coordinate are known,

the CGA-CSA is able to execute multiple sonications with different features reading the

informations from an *.ini file. In order to automatically execute these operations, a MatLab®

(MathWorks) custom code was wrote (Figure 4) able also to produce in output an *.ini file that can

be read by the machine. More precisely, a relationship between the inner reference system of the

FUS apparatus and the system of the code was established. This step was made in order to reduce

the preparation phase and to plan the parameters of each well before the calibration phase.


87

Figure 4. The planning interface of the custom code.

Results

Radiation Force tests. In order to evaluate the radiation force, 213 tests were performed.

Summarized data were listed in table 1.

Table 1 displays also the real electrical power (Pel,Real) emitted by the transducer during each

sonication, obtained by CGA – CSA software. Trials were made with a mean duration d of 20

seconds and an average of 11 repetitions for each power. Frad was obtained multiplying the apparent

weight reduction w, read from the scale, for the gravitational acceleration g. For every value of

radiation force, the type A uncertainty U% has been calculated with a confidence interval of the 95

percentile. There's no value with an uncertainty over 5%.

1 0,9 0,5 0,37 4,42

1,5 1,6 0,93 0,49 2,58

2 2,1 1,24 0,68 2,07

2,5 2,6 1,55 0,82 1,77

3 3,3 1,86 1,05 1,34

3,5 3,2 2,17 1,11 2,60

4 4 2,48 1,37 0,75

4,5 4,4 2,79 1,52 1,69

5 5,2 3,1 1,79 1,25

5,5 5,6 3,41 1,85 0,66

6 6 3,72 2,01 0,67

6,5 6,5 4,03 2,16 1,76

7 7,5 4,34 2,57 1,74

7,5 8,1 4,65 2,64 0,92

8 8,6 4,96 2,87 0,71

8,5 8,6 5,27 3,11 1,45

8,5 9,1 5,58 2,95 0,98

9 9,8 5,89 3,27 0,47

9,5 10,3 6,2 3,17 3,35

Pel [W] Pel,Real [W] Wac,sf [W] Frad [mN] U(Pel) [%]


88

The maximum type A uncertainty recorded is 4,42% for the lower power of 1W which produces an

apparent weight reduction w of 0,037 g: too close to the sensitivity of the scale. Those medium

values were fitted with a straight line forced to the origin of the axes trough a ordinary least squares

regression:

F Rad = 0,332154Pel,Real [mN ]

The data and the fit were shown in the Figure 5. The coefficient of determination R2, was 0,998.

0 0,5 1 1,5 2 2,5 3 3,5 4 4,5 5 5,5 6 6,5 7 7,5 8 8,5 9 9,5 10 10,50

0,5

1

1,5

2

2,5

3

3,5

Radiation Force

P_el,Real [W]

F_ra

d [m

N]

Figure 5. Linear relation between the electric power absorbed by the transducer Pel,Real and the

relative radiation force perceived by the digital scale Frad. Straight Line: Linear interpolation;

Crosses: experimental mean values.

Geometrical Tests. An area of the plate, that is shadowed by the ring of the coupling system, was

been identified thanks to the 3D model (Figure 3). This kind of interference is reasonable that

would not have been recognized without any kind of imaging. To verify the correspondence

between wells coordinates in the 3D model and in the real system (Figure 7), a test was done

looking the sonication effect on the water surface (acoustic streaming) in some well of the plate.

The 96-wells plate position was been not always the same, so a calibration of coordinates is needed

to guarantee the correct position of each sonications. Usually a 5 mm correction of coordinates was

been enough.


89

Figure 6. The figure displays the system adopted to perform geometrical tests.

The software stores the last values used and suggests these to the user for the next calibration.

Calibration in the z direction was done comparing reflection graph in the acquisition part of the

CGA – CSA software, with the predicted z into the 3D model. In figure 2, the reflection from the

water table at the head of the well (z ≈ 125 mm) was visible. The software reliability was tested

with the phantoms described above. All the prescribed wells were sonicated with an adequate

spatial precision, as shown by the evident denaturation of BSA proteins, displayed in figure 7.

Figure 7. Polyacrylamide Gel-Phantoms used to test our system. In red the name of the well

sonicated; under that, repetitions, power and duration of the exposition. Gray scale images contrast

was enhanced with GIMP.


90

Discussion

According to Buldakov's et al (12), it is very difficult to derive solid theories from the in vitro

ultrasounds experimentations due to a lack of systematic works describing accurately all of the

parameters involved in the experiments. Going beyond this, a series of controls to ensure the

repeatability and the accuracy of our in vitro experiments was been established. The spots position

in the space was assessed employing a custom made software based on a 3D model of the system.

Its reliability was first verified visually, then established with the protein denaturation of some

specifically made gel phantoms placed inside a 96 well plate. The acoustic power delivered was

assessed with a series of test, obtaining a linear relation between the electric power requested by the

transducer and the radiation force perceived by the target. The experience gained allowed us to

write two separate sessions of controls that fit our needs in an easy and cheap manner, making our

results almost operator independent.

Conclusions

In this technical report we described the main procedures that we performed to obtain an efficient

ultrasound system for in vitro experiment. The experience gained allowed us to write two separate

sessions of controls that fit our needs in an easy and cheap manner, making our results almost

operator independent.

References

1.Schlesinger D, Benedict S, Diederich C, Gedroyc W, Klibanov A, Larner J. MR-guided focused

ultrasound surgery, present and future. Med. Phys. 40 (8), August 2013.

2.National Council on Radiation Protection and Measurements REPORT N° 74. biological effects

of ultrasound: mechanisms and clinical implications. The Council, 01/lug/1983.

3.National Council on Radiation Protection and Measurements (NCRP), Diagnostic Ultrasound

Safety: A summary of NCRP technical report no. 140: Exposure Criteria for Medical Diagnostic

Ultrasound: II. Criteria Based on all Known Mechanisms, 2002 (On line). Available on line:

HTTP://www.ncrponline.org/Publications/Reports/Misc_PDFs/UltrasoundSummary--NCRP.pdf

4.Ang Jr. E, Gluncic V, Duque A, et al. Prenatal exposure to ultrasound waves impacts neuronal

migration in mice. Proc Natl Acad Sci USA. 2006.

5.Sapareto DG, Dewey WC. Thermal dose determination in cancer therapy. Br J Radiation

Oncology Biol Phys Med 1984;10:787–800.


91

6.Dewhirst MW, Viglianti BL, Lora-Michiels M, Hanson M, Hoopes PJ. Basic principles of

thermal dosimetry and thermal thresholds for tissue damage from hyperthermia. Int J Hyperthermia

2003;19:267–294.

7.Taran A, Tempany CM, Egan L, Inbar Y, Revel A, and Stewart EA. Magnetic resonance-guided

focused ultrasound (MRgFUS) compared with abdominal hysterectomy for treatment of uterine

leiomyomas. Ultrasound Obstet. Gynecol. 34, 572–578 (2009).

8.Ripamonti and F. Fulfaro, “Malignant bone pain: Pathophysiology and treatments,” Curr. Rev.

Pain. 4, 187–196 (2000).

9.Li S, Wu P. Magnetic resonance image-guided versus ultrasound-guided high-intensity focused

ultrasound in the treatment of breast cancer. Chin J Cancer; 32(8): 441–452, 2013.

10.Dickinson L, Ahmed HU, Kirkham AP, Allen C, Freeman A, Barber J, Hindley RG, Leslie T,

Ogden C, Persad R, Winkler MH, Emberton M. A multi-centre prospective development study

evaluating focal therapy using high intensity focused ultrasound for localised prostate cancer: The

INDEX study. Contemp Clin Trials;36(1):68-80, 2013.

11.Elias WJ, Huss D, Voss T, Loomba J, Khaled M, Zadicario E, Frysinger RC, Sperling SA, Wylie

S, Monteith SJ, Druzgal J, Shah BB, Harrison M, Wintermark M. A pilot study of focused

ultrasound thalamotomy for essential tremor. N Engl J Med;369(7):640-8, 2013.

12.Buldakov MA, Hassan MA, Zhao QL, Feril LB Jr, Kudo N, Kondo T, Litvyakov NV, Rostov

VV, Cherdyntseva NV, Riesz P. Influence of changing pulse repetition frequency on chemical and

biological effects induced by low-intensity ultrasound in vitro. Ultrason Sonochem. 2009

Mar;16(3):392-7.

13.Brotchie A, Grieser F, Ashokkumar M. Effect of power and frequency on bubble-size

distributions in acoustic cavitation. Phys Rev Lett; 102, 084302, 2009.

14.Marmottant P, Hilgenfeldt S. Controlled vesicle deformation and lysis by single oscillating

bubbles. Nature, 423 , 153. Nature. 2003 May 8; 423(6936):153-6.

15.Ohl CD, Arora M, Ikink R,de Jong N,Versluis M, Delius M, Lohse D. Sonoporation from Jetting

Cavitation Bubbles. Biophys J. Dec 1, 2006; 91(11): 4285–4295. Published online Sep 1, 2006.

16.Maxwell AD, Wang TY, Cain CA, Fowlkes JB, Sapozhnikov OA, Bailey MR, Xu Z. Cavitation

clouds created by shock scattering from bubbles during histotripsy. J Acoust Soc Am. 2011

Oct;130(4):1888-98.

17.Gourevich D, Hertzberg Y, Volovick A, Shafran Y, Navon G, Cochran S, Melzer A. Ultrasound-

mediated targeted drug delivery generated by multifocal beam patterns: an in vitro study.

Ultrasound Med Biol, 2013.


92

18.Kolárová H, Bajgar R, Tománková K, Krestýn E, Dolezal L, Hálek J. In vitro study of reactive

oxygen species production during photodynamic therapy in ultrasound-pretreated cancer cells.

Physiol Res;56 Suppl 1:S27-32, 2007.

19.Feril LB Jr, Kondo T, Cui ZG, Tabuchi Y, Zhao QL, Ando H, Misaki T, Yoshikawa H,

Umemura S. Apoptosis induced by the sonomechanical effects of low intensity pulsed ultrasound in

a human leukemia cell line. Cancer Letters - Volume 221, Issue 2, 28 April 2005.

20.Jiang Z, Wu W, Qian ML. Cellular damage and apoptosis along with changes in NF-kappa B

expression were induced with contrast agent enhanced ultrasound in gastric cancer cells and

hepatoma cells. Cancer Cell Int. 2012 Mar 15;12(1):8. doi: 10.1186/1475-2867-12-8.

21.Hirokawa N, Koito K, Okada F, Kudo N, Yamamoto K, Fujimoto K, Nishida M, Ichimura T,

Hori M, Satoh T, Hareyama M. High-intensity focused ultrasound induced apoptosis with caspase

3, 8, and 9/6 activation in rat hepatoma. Journal of Medical Ultrasonics. 36(4):177-185. DOI:

10.1007/s10396-009-0234-2.

22.Miller DL, Dou C. Induction of apoptosis in sonoporation and ultrasonic gene transfer.

Ultrasound Med Biol. 2009 Jan;35(1):144-54. doi: 10.1016/j.ultrasmedbio.2008.06.007. Epub 2008

Aug 23.

23.Liu Y, Kon T, Li C, Zhong P. High intensity focused ultrasound-induced gene activation in

sublethally injured tumor cells in vitro. J Acoust Soc Am. Author manuscript; available in PMC

Aug 14, 2007. Published in final edited form as: J Acoust Soc Am. Nov 2005; 118(5): 3328–3336.

doi: 10.1121/1.2041247.

24.Harada Y, Ogawa K, Irie Y, Endo H, Feril LB Jr, Uemura T, Tachibana K. Ultrasound activation

of TiO2 in melanoma tumors. J Control Release. 2011 Jan 20;149(2):190-5.

25.Buldakov MA, Feril LB Jr, Tachibana K, Cherdyntseva NV, Kondo T. Low-intensity pulsed

ultrasound enhances cell killing induced by X-irradiation. Ultrason Sonochem. 2014 Jan.

26.Borasi G, Melzer A, Russo G, Nahum A, Zhang Q, Alongi F, Vicari F, Gilardi MC. Cancer

therapy combining high-intensity focused ultrasound and megavoltage radiation. Int J Radiat Oncol

Biol Phys. 2014 Jul 15;89(4):926-7. doi: 10.1016/j.ijrobp.2014.03.025. Epub 2014 May 28.

27.Eisenbrey JR, Huang P, Hsu J, Wheatley MA. Ultrasound triggered cell death in vitro with

doxorubicin loaded poly lactic-acid contrast agents. Ultrasonics. 2009 Dec;49(8):628-33.

28.Gorny KR, Hangiandreou NJ, Hesley GK, Gostout BS, McGee KP, Felmlee JP. MR guided

focused ultrasound: technical acceptance measures for a clinical system. Phys Med

Biol;51(12):3155-73, 2006.

29.InSightec Ltd. Operator’s Manual For the ExAblate® System for Treatments of Uterine Fibroids

and Adenomyosis Original Instructions. February 2012.


93

30.Militello C, Vitabile S, Russo G, Candiano G, Gagliardo C, Midiri M, Gilardi M C. A Semi-

automatic Multi-seed Region-Growing Approach for Uterine Fibroids Segmentation in MRgFUS

Treatment. Complex, Intelligent, and Software Intensive Systems (CISIS), 2013 Seventh

International Conference on , vol., no., pp.176,182, 3-5 July 2013.

31.Yu T, Wang Z, Mason TJ. A review of research into the uses of low level ultrasound in cancer

therapy. Ultrason Sonochem. 2004 Apr;11(2):95-103.

32.Lafon C, Zderic V, Noble ML, Yuen JC, Kaczkowski PJ, Sapozhnikov OA, Chavrier F, Crum

LA, Vaezy S. Gel phantom for use in high-intensity focused ultrasound dosimetry. Ultrasound Med

Biol. 2005 Oct;31(10):1383-9.


94

Technical analysis of cell growth and viability induced by ultrasounds in-vitro treatments: a

preliminary approach.

Valentina Bravatà1, Luigi Minafra1, Giorgio Russo1, Roberta Cirincione1, Cristina Messa1,2,3, Maria

C Gilardi1,3,4 Giusi Irma Forte1 and Francesco P Cammarata1*


Cefalu (PA), Italy; 2Nuclear Medicine Center, San Gerardo Hospital, Monza, Italy; 3Department of Health Sciences, Tecnomed Foundation, University of Milano-Bicocca, Milan, Italy; 4Nuclear Medicine, San Raffaele Scientific Institute, Milan, Italy

Abstract

The potential use of ultrasounds for therapeutic purposes has been known

since the early decades of the last century. To date, only a few applications

for clinical use exist, such as the ablative treatment of uterine fibroids,

prostate cancer and palliative pain treatment of bone metastases. Much more

disparate are the on-going biological researches and clinical trial, on the

therapeutic use of low and high intensity ultrasounds predominantly, but not

exclusively, in the oncology and neurologic fields. In this technical report

we described the main procedures that we performed to obtain an efficient

experimental set-up for in vitro studying of biological effects produced by

ultrasound. Our data underline that future efforts are needed in order to

understand cell and molecular mechanisms activated by an HIFU treatment.



95

Introduction

The first studies on the biological effects of ultrasounds (US) are dated at the beginning of 1900s,

when the interaction between living tissues and high intensity and frequency sound waves were

analysed (1). Then, in 1940 and 1950 William Fry and collaborators produced deep lesions in brains

of cats and monkeys to study the use of focused US for therapeutic tissue ablation, but the lack of a

precise imaging system limited their use till two decades ago (2-4). Nowadays, High Intensity

Focused Ultrasounds (HIFU) systems, in combination with Magnetic Resonance Imaging

(MRgFUS) or diagnostic ultrasounds (USgFUS) have become a new medical non-invasive

therapeutic approach, thanks to their potentiality to obtain combinations of biological effects by

modulating thermal, mechanical and chemical effects produced by the propagation of high and low

energy waves through living tissues. The current HIFU clinical approved applications are finalized

to the ablation of uterine fibroids, prostatic cancer and the palliative pain treatments of bone

metastases. Moreover different clinical experimentations are on-going worldwide in the field of

solid tumours ablation, as well as treatments of neurodegenerative diseases, pain and vascular

problems, to maximise the use of this technology (5). Besides, novel therapeutic horizons become

visible for the near future battle against cancer and neurologic diseases; since drug delivery, blood

barrier opening, hyperthermia and cell sensitization to radiation treatments, modulating the waves

beam intensity, render the use of US an adjuvant therapy in combination to traditional surgery,

radiation or chemotherapy treatments (6).

Although the definition of “ultrasonic dose” is still debated, the following three main physical

consequences are caused by the ultrasonic waves propagation across tissues: the thermal,

mechanical and acoustic streaming effects. Thermal effects are the result of the tissue specific

ability to absorb acoustic energy and can be easily monitored in clinical use by MR- thermometry

(7). According to the final desired purpose, this effect can be utilized to induce hyperthermia,

sensitizing tissues and enlarging membranes and junctions of normal tissue structures, or to provoke

cells killing through the phenomenon called “coagulative necrosis”, within ablative regimen.

Moreover, the transient nature of heating (time-dependent temperature changes) and the different

heat sensitivity of various tissues must be considered in order to better understand cell response.

More precisely, the extent of thermal damage to tissue depends on tissue sensitivity, temperature

and exposure time. In vitro studies showed that the rate of cell death is exponential with respect to

temperature over a limited temperature range (40–55 °C) (8-9). While sensitivity to heat is different

across species as well as across different tissues and organs, a breakpoint in the rate of cell death

was detected in cell culture around 43 °C and generalized as a part of the calculation of thermal

dose.


96

At present, a conspicuous number of potentially interesting US applications, which do not rely

solely to the direct tissue destruction, are currently on-going in vitro and preclinical research

subjects. These topics are interesting, not only from a purely scientific point of view, but reserve

promising potential applications for the introduction of revolutionaries and personalized therapeutic

interventions in the next decades. However, despite the biological research is very intense on

several fields, in this proteogenomic era, there is still the need for a deep comprehension of

molecular mechanisms sustaining the biological effects of US. For this purpose in this technical

report we describe our preliminary analysis of cell growth and viability induced by ultrasounds in in

vitro treatments. In particular, we used the human non-tumorigenic breast epithelial MCF10A cell

line and the human breast adenocarcinoma MCF7 and MDA-MB-231 cell lines to perform HIFU

and Water Bath Hyperthermia Treatments (WBHT) treatments. We trust that this technical report

could be useful to design the better experimental design, in order to study cell response to thermal

and non thermal effects caused by US treatments.


Cell cultures. The human non-tumorigenic breast epithelial MCF10A cell line and human breast

adenocarcinoma MCF7 and MDA-MB-231 cell lines were purchased from the American Type

Culture Collection (Manassas, VA, USA) and cultured according to ATCC instructions. All cell

culture media and supplements were obtained from Invitrogen (Carlsbad, CA, USA). Cells were

maintained in an exponentially growing culture condition at 37˚C in a 5% CO2 incubator and

treated at subconfluence under sterile conditions. Cells were seeded in appropriate cell culture

plates before different treatments and were treated at subconfluence.

High Intensity Focused Ultrasound treatment. Ultrasound experiments were conducted using the

the InSightec ExAblate 2100 (InSightec Ltd, Tirat Carmel, Israel) MRgFUS equipment (10). It

incorporates a 208 elements phased array transducer which can operate with a frequency that varies

from 0,9 to 1,3 MHz and an energy from 100 to 6000 J. This transducer has 5 degrees of freedom in

the space: it can be elevated (Z), moved in the horizontal plane (XY) and rotated around the two

axes that form this plane (roll and pitch angles). The transducer can be moved through its axis

thanks to CGA – CSA. 4.75.24.(00) software. To overcome the deficit of an ultrasound guide and

predict beams path, we have recently developed the 3D model that reproduces the essential parts of

the ExAblate 2100 in the in vitro configuration and relative 96-well plate localization (data not

shown). The spots position in the space was assessed employing a custom made software based on a

3D model of the system. For the in vitro experiments, different HIFU treatment conditions in term


97

of duration, intensity and end time points, were chosen. More precisely, MCF10A mammary

epithelial cell and MCF7 BC cells were exposed to HIFU beams with the following characteristics:

duration treatment of 3 and 30 seconds, a variable acoustic power of 2, 5 and 10 W, and two end-

points of 24 and 48 h after treatment.

Water Bath Hyperthermia treatments. During HIFU treatment, the acoustic waves interact with cell

or tissue through thermal and non-thermal physical mechanisms, to produce a wide range of

bioeffects. In order to study the bioeffects generated solely by thermal physical mechanisms and to

compare these effects with those caused by both thermal and non-thermal physical mechanisms

taking together generated by HIFU treatment, we performed hyperthermia treatments on MDA-MB-

231 cells by using water bath. Moreover, we used the cumulative equivalent minutes at 43 °C

(CEM43°C) thermal dose isoeffect model, introduced by Sapareto and Dewey, based on a simple

concept that translates all different temperature-time histories to a single number representing a

“thermal isoeffect" (11-12). More precisely, we analyzed the MDA-MB-231 cell viabilities after

water bath hyperthermia treatments (WBHT) with the following conditions: CEM 43°C for 15

minutes.

MTS Assay Protocol. Cell viability was determined by MTS assay (CellTiter 96® AQueous One

Solution Cell Proliferation Assay) according to the manufacturer's protocol (Promega,Southampton,

UK). This test represents a colorimetric assay based on the ability of the viable cells to reduce a

soluble yellow tetrazolium salt to blue formazan. Briefly, the main steps of the protocol are: 1)

optimization of the cell seeding density (5x103-15x103 cells per well) in 96-well plates containing a

final volume of 100 µl/well; a set of wells can be prepared with medium only for background

subtraction; 2) HIFU and WBHT treatments; 3) plate incubation at 37°C for desired period of

exposure (24-72 hours); 3) addition of 20 µl MTS solution in each well (final concentration of MTS

will be 0.33 mg/ml); 4) plate incubation at 37°C for 1–4 hours; 5) measure of absorbance at 490 nm

using a Wallac 1420 Victor 3V plate reader Perkin-Elmer Life Sciences, Boston, USA). The

percentages of surviving cells relative to untreated controls were determined.

Cell growth curves. MDA MB-231 cells (treated and untreated as control) were seeded at a density

of 15x104 in 24-well plates. Cell counting was performed in a Burker chamber at differents time

points after treatments (6-24-48 hours) under a Zeiss Axiovert phase-contrast microscope (Carl

Zeiss, Göttingen, Germany).


98

Results

MCF10A and MCF7 HIFU treatments. To date, a conspicuous number of potentially interesting US

applications, which do not rely solely to the direct tissue destruction, are currently on-going in vitro

and preclinical research subjects. Despite the biological research is very intense on several fields, in

this proteogenomic era, there is still the need for a deep comprehension of molecular mechanisms

sustaining the biological effects of US. In particular, in this technical report we analyze the cell

viabilities of MCF10A mammary epithelial cells and MCF7 BC cells treated with different

ultrasound exposure configurations, in order to study cell behaviors after different treatment

conditions in term of duration, acoustic power and end time points. More precisely, MCF10A and

MCF7 cells were exposed to HIFU beams with the following characteristics: duration treatment of 3

and 30 seconds (s), a variable acoustic power of 2, 5 and 10 W, and two end-points of 24 and 48 h

after treatment. As shown in figure 1A and 1B, MCF7 treated for 3s and 30s with HIFU, displayed

an increase of cell viability 24h after treatments with all the above mentioned acoustic power

values. On the contrary, MCF7 treated with the acoustic power of 10 W for 30s showed a decreased

of cell viability at 24h respect to control sample (CTRL).

In addition, 48h after HIFU treatments (both 3s and 30s), MCF7 cells showed a little decrease of

cell viability with 2 and 5 W. Moreover, no variation and a strong decreasing were observed after

10 W for 3s and 30s, respectively.

As regard MCF10A cells, a little increase of cell viability at both 24h and 48h after HIFU 3s

treatments with 2, 5 and 10 W was observed (figure 1C). Otherwise, as displayed in figure 1D,

A) C)

B) D)


99

MCF10A HIFU 30s treated showed a mild increase of cell viability at both 2 and 5 W after 24h and

48h while, using 10W, a strong decrease at both time points was observed.

MDA-MB-231 WBHT treatments. Although the definition of “ultrasonic dose” is still debated, the

following three main physical consequences are caused by the ultrasonic waves propagation across

tissues: the thermal, mechanical and acoustic streaming effects. In order to study cell response to

thermal physical mechanisms and to compare these bioeffects with those caused by both thermal

and non-thermal physical mechanisms taking together generated by HIFU treatment, we performed

hyperthermia treatments on MDA-MB-231 cells by using a water bath. More precisely we analyzed

the MDA-MB231 cell growth and viability after CEM43°C for 15 minutes.

We observed a surviving fraction of 67% compared to untreated cells after 48h post WBHT. This

trend was also confirmed by MTS assay, were a surviving fraction of 62% was measured (data not

shown).

Discussion

US irradiation of cancer cell lines in conjunction with other kind of treatments such as

hyperthermia, radiotherapy and chemotherapy, produces in vitro synergistic effects to cell death,

described as the overall decrease in number of viable cells and inhibition of cancer cell proliferation

(13-17). In order to investigate the potential of US in these applications, in vitro researches are

essential, to identify and better understand molecular mechanisms induced within cells and tissues.

US therapeutic strategies are based on the capability of acoustic waves to interact with tissues

through thermal and non-thermal physical mechanisms. More precisely, when the acoustic waves

interact with cells or tissues, they cause a temperature increase due to the conversion of acoustic

energy into heat. In line, the power of the bioeffects generated, is related to the total acoustic power

delivered and the duration of the exposure that are able to produce different temperatures and

outcomes. Despite the considerable interest in US clinical use, a major effort should be directed to

understand better the cell and molecular mechanisms activated after treatments. To this aim, in this

technical report we describe our experience in studying breast cancer cell growth and viability after

HIFU and WBHT treatments.

We studied cell response, in terms of cell viability, to thermal mechanisms (generated by WBHT

treatment) and to both thermal and non-thermal mechanisms taking together (caused by HIFU

treatment).

On one hand we analyzed the cell viabilities of MCF10A cell and MCF7 BC cell HIFU exposed

with variable duration (3 and 30s), acoustic power (2, 5 and 10 W) and end time points (24-48h).


100

As shown in figure 1A and 1B, MCF7 treated for 3s and 30s with ultrasound, displayed an increase

of cell viability 24h after treatments with all the above mentioned acoustic power values selected.

On the contrary, MCF7 treated with 10 W for 30s showed a decreased of cell viability respect to the

untreated sample. In addition, 48h after HIFU treatments (both 3s and 30s), MCF7 cells showed a

little decrease of cell viability with 2 and 5 W of acoustic power. Moreover, no variation and a

strong decreasing were observed after 10 W for 3s and 30s, respectively. As regard MCF10A cells,

a little increase of cell viability was observed at both 24h and 48h after 3s with 2, 5 and 10 W

(figure 1C). Otherwise, as displayed in figure 1D, MCF10A irradiated with ultrasound for 30s at

both 2 and 5 W showed a mild increase of cell viability after 24h and 48h, while using 10W a

strong decrease at both time points was observed.

In summary, MCF7 cell viability after 24h increased delivering 2, 5 and 10W of acoustic power for

3s and 30s, except treating with the configuration 30s-10W, were a decrease was observed.

Otherwise, 48h post HIFU treatments, cells showed from little to moderate decrease of cell viability

independently by the parameters configuration investigated.

Regarding MCF10A cells HIFU treated, an increasing of cell viability was observed in all the

experiments performed excepting in cells exposed to HIFU 30s-10 W, were a decrease at both 24h

and 48h time points, was measured.

On the other hand, MDA-MB-231 cell WBHT exposed, showed at 48h a decrease of cell growth

rate and viability respect to control. This results are in line with those obtained at 48h after an HIFU

treatment and seem to be cell type and time point independent.

Taking together these results show how a better clarification of cell response is needed to

understand cell and molecular mechanisms HIFU activated because a lot of variable in term of

treatments modalities and relative results were collected, and thus up to now, no generic

assumptions could be proposed.

Conclusions

In this technical report we described the main procedures that we performed to obtain an efficient

ultrasound system experiments set-up for in vitro analysis. Our data underline that future efforts are

needed in order to understand cell and molecular mechanisms activated by an HIFU treatment.

In fact, the biological effects produced by modulating ultrasound beams, highlight the necessity of

further deep physical and biological characterization by in vitro approaches, at support of more

advanced in vivo studies.


101

References

1.Harvey EN, Harvey EB, Loomis AL. Further observation on the effect of high frequency sound

waves on living matter. Bio Bull 1928; 55(6): 459-469

2.Lynn JG, Zwemer RL, Chick AJ, Miller AE. A new method for the generation and use of focused

ultrasound in experimental biology. J Gen Physiol 1942; 26(2): 179-193

3.Fry WJ, Mosberg WH, Barnard JW, Fry FJ. Production of focal destructive lesions in the central

nervous system with ultrasound. J Neurosurgery 1954; 11:471-8

4.Fry WJ, Barnard JW, Fry FJ, Krumins RF, Brennan JF. Ultrasonic lesions in the mammalian

central nervous system. Science 1955; 122:517-8.

5.Kennedy JE. High-intensity focused ultrasound in the treatment of solid tumours. Nat Rev

Cancer. 2005; 5: 321-7.

6.Borasi G, Russo G, Alongi F, et al. High-intensity focused ultrasound plus concomitant

radiotherapy: a new weapon in oncology?. J Ther Ultrasound. 2013 1;1:6.

7.Wu F, Wang ZB, Cao YD, et al. Heat fixation of cancer cells ablated with high intensity-focused

ultrasound in patients with breast cancer. Am J Surg 2006;192:179-84.

8.Dewey WC. Arrhenius relationships from the molecule and cell to the clinic. Int J

Hyperthermia.1994; 10:457–483.

9.Hall EJ, Roizin-Towle L. Biological effects of heat. Cancer Res. 1984; 44:4708s–4713s.

10.Militello C, Vitabile S, Russo G, Candiano G, Gagliardo C, Midiri M, Gilardi M C. A Semi-

automatic Multi-seed Region-Growing Approach for Uterine Fibroids Segmentation in MRgFUS

Treatment. Complex, Intelligent, and Software Intensive Systems (CISIS), 2013 Seventh

International Conference on , vol., no., pp.176,182, 3-5 July 2013.

11.Sapareto SA, Dewey WC. Thermal dose determination in cancer therapy. Int J Radiat Oncol Biol

Phys. 1984; 10:787–800.

12.van Rhoon GC, Samaras T, Yarmolenko PS, Dewhirst MW, Neufeld E, Kuster N. CEM43°C

thermal dose thresholds: a potential guide for magnetic resonance radiofrequency exposure levels?

Eur Radiol. 2013 Aug;23(8):2215-27.

13.Liu Y, Kon T, Li C, Zhong P. High intensity focused ultrasound-induced gene activation in

sublethally injured tumor cells in vitro. J Acoust Soc Am. Author manuscript; available in PMC

Aug 14, 2007. Published in final edited form as: J Acoust Soc Am. Nov 2005; 118(5): 3328–3336.

doi: 10.1121/1.2041247.

14.Harada Y, Ogawa K, Irie Y, Endo H, Feril LB Jr, Uemura T, Tachibana K. Ultrasound activation

of TiO2 in melanoma tumors. J Control Release. 2011 Jan 20;149(2):190-5.


102

15.Buldakov MA, Feril LB Jr, Tachibana K, Cherdyntseva NV, Kondo T. Low-intensity pulsed

ultrasound enhances cell killing induced by X-irradiation. Ultrason Sonochem. 2014 Jan.

16.Borasi G, Melzer A, Russo G, Nahum A, Zhang Q, Alongi F, Vicari F, Gilardi MC. Cancer

therapy combining high-intensity focused ultrasound and megavoltage radiation. Int J Radiat Oncol

Biol Phys. 2014 Jul 15;89(4):926-7. doi: 10.1016/j.ijrobp.2014.03.025. Epub 2014 May 28.

17.Eisenbrey JR, Huang P, Hsu J, Wheatley MA. Ultrasound triggered cell death in vitro with

doxorubicin loaded poly lactic-acid contrast agents. Ultrasonics. 2009 Dec;49(8):628-33.


103

Collana dei rapporti tecnici annuali dell'Istituto di ... Tecnico_Volume 1.pdf · ISSN: 2531-3878...

Documents

Transcript of Collana dei rapporti tecnici annuali dell'Istituto di ... Tecnico_Volume 1.pdf · ISSN: 2531-3878...