UNIVERSITA DEGLI STUDI DI TRIESTE` - units.it · Universit`a degli Studi di Torino Dr. Claudio...

UNIVERSITA DEGLI STUDI DI TRIESTE

DIPARTIMENTO DI BIOCHIMICA, BIOFISICA e CHIMICA DELLE

MACROMOLECOLE

DOTTORATO DI RICERCA IN MEDICINA MOLECOLARE

XX CICLO

Settore Scientifico-disciplinare: Biologia Molecolare (Bio/11)

Role of Unconjugated Bilirubin

in the Endothelial DysfunctionDottoranda:Graciela Lujan Mazzone

Coordinatore del Collegio Docenti:

Prof. Giannino Del SalUniversita degli Studi di Trieste

Relatore:

Prof. Claudio TiribelliUniversita degli Studi di Trieste

Correlatore:

Dott. Igino RigatoUniversita degli Studi di Trieste

Supervisor:

Prof. Claudio TiribelliUniversita degli Studi di Trieste

Tutor:

Dr. Igino RigatoUniversita degli Studi di Trieste

External Supervisor:

Dr. Helena SchteingartCentro de Investigaciones Endocrinologicas - CONICET - Argentina

Thesis Committee:

Prof. Francesco TedescoUniversita degli Studi di Trieste

Prof. Stefano GustincichScuola Internazionale Superiore di Studi Avanzati di Trieste

Prof. Massimo LevreroUniversita degli Studi di Roma - La Sapienza

Prof. Franco VitturUniversita degli Studi di Trieste

Prof. Silvia GiordanoUniversita degli Studi di Torino

Dr. Claudio BrocoliniUniversita degli Studi di Udine

Prof. Giannino Del SalUniversita degli Studi di Trieste

Prof. Renato GennaroUniversita degli Studi di Trieste

palabra

This study was supported by a fellowship from the Italian Ministry of Foreign

Affairs (MAE) in Rome, Italy. In particular, I wish to thank Dr. Paola Ranocchia.

Contents

Abstract xiii

Publications xvii

Abbreviations xix

1 Introduction 11.1 Bilirubin metabolism . . . . . . . . . . . . . . . . . . . . . . . . 1

1.2 Bilirubin and pathophysiology . . . . . . . . . . . . . . . . . . . 3

1.3 Vascular atherosclerosis . . . . . . . . . . . . . . . . . . . . . . . 7

1.3.1 Morphology of atherosclerotic lesions . . . . . . . . . . . 7

1.3.2 Atherogenesis - Response to the injury theory . . . . . . . 10

1.3.3 Endothelium . . . . . . . . . . . . . . . . . . . . . . . . 11

1.4 Pro-inflammatory cytokines . . . . . . . . . . . . . . . . . . . . . 14

1.5 Nitric oxide . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 16

1.5.1 Biosynthesis of nitric oxide . . . . . . . . . . . . . . . . 17

1.5.2 Endothelial Nitric Oxide Synthase (eNOS) . . . . . . . . 20

1.5.3 Inducible Nitric Oxide Synthase (iNOS) . . . . . . . . . . 22

1.5.4 Nitric oxide and pathophysiology . . . . . . . . . . . . . 24

1.6 Adhesion molecules . . . . . . . . . . . . . . . . . . . . . . . . . 27

1.6.1 The Selectins . . . . . . . . . . . . . . . . . . . . . . . . 29

1.6.2 Immunoglobulin superfamily adhesion molecules . . . . . 33

1.7 Signal transduction pathways . . . . . . . . . . . . . . . . . . . . 39

1.7.1 cAMP-response element(CRE)-binding protein (CREB) . 40

1.7.2 NF-κB . . . . . . . . . . . . . . . . . . . . . . . . . . . 41

v

CONTENTS

2 Aim of the Study 51

3 Materials and Methods 533.1 Endothelial Cells . . . . . . . . . . . . . . . . . . . . . . . . . . 53

3.2 Materials . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 54

3.3 UCB solutions . . . . . . . . . . . . . . . . . . . . . . . . . . . . 55

3.4 Culture conditions . . . . . . . . . . . . . . . . . . . . . . . . . . 57

3.4.1 Cytokines treatment . . . . . . . . . . . . . . . . . . . . 58

3.5 Endothelial cell susceptibility . . . . . . . . . . . . . . . . . . . . 58

3.5.1 LDH release test . . . . . . . . . . . . . . . . . . . . . . 58

3.5.2 Mitochondrial toxicity by MTT test . . . . . . . . . . . . 59

3.6 Endothelial dysfunction analysis . . . . . . . . . . . . . . . . . . 60

3.6.1 Nitric oxide . . . . . . . . . . . . . . . . . . . . . . . . . 60

3.6.2 Gene expression analysis . . . . . . . . . . . . . . . . . . 62

3.6.3 Western blot . . . . . . . . . . . . . . . . . . . . . . . . 63

3.7 Signal transduction pathways . . . . . . . . . . . . . . . . . . . . 66

3.7.1 cAMP-response element(CRE)-binding protein (CREB) . 66

3.7.2 Preparation of total nuclear extracts . . . . . . . . . . . . 67

3.8 Statistical analysis . . . . . . . . . . . . . . . . . . . . . . . . . . 68

4 Results 694.1 Effects of UCB on cell viability . . . . . . . . . . . . . . . . . . 69

4.1.1 UCB did not affect the LDH release induced by TNF-α . 69

4.1.2 UCB reduced endothelial cell viability . . . . . . . . . . 69

4.2 Nitric oxide analysis . . . . . . . . . . . . . . . . . . . . . . . . 71

4.2.1 Effect of UCB on NO levels in H5V cells . . . . . . . . . 73

4.2.2 Effect of UCB on NOS mRNA expression . . . . . . . . . 73

4.2.3 NO levels in HUVEC cells . . . . . . . . . . . . . . . . . 75

4.2.4 UCB, the redox status and NO levels . . . . . . . . . . . 75

4.3 UCB reduced AM expression induced by TNF-α . . . . . . . . . 80

4.3.1 H5V cells - mRNA relative expression . . . . . . . . . . . 80

4.3.2 HUVEC cells - mRNA relative expression . . . . . . . . . 84

4.4 AM protein expression . . . . . . . . . . . . . . . . . . . . . . . 88

vi

CONTENTS

4.5 UCB effects via NF-κB pathway . . . . . . . . . . . . . . . . . . 96

4.5.1 UCB and PDTC inhibit gene over-expression in an addic-

tive pattern . . . . . . . . . . . . . . . . . . . . . . . . . 96

4.5.2 CREB phosphorylation is not influenced by UCB . . . . . 96

4.5.3 NF-κB nuclear translocation is inhibited by UCB . . . . . 99

5 Discussion 1035.1 Viability and UCB . . . . . . . . . . . . . . . . . . . . . . . . . 104

5.2 Nitric oxide and UCB . . . . . . . . . . . . . . . . . . . . . . . . 108

5.3 Adhesion molecules and UCB . . . . . . . . . . . . . . . . . . . 113

5.4 Signalling pathways and UCB . . . . . . . . . . . . . . . . . . . 114

6 Conclusions 119

Acknowledgements 121

References 122

Reprints 161

vii

List of Figures

1.1 Bilirubin metabolism . . . . . . . . . . . . . . . . . . . . . . . . 2

1.2 Hepatic heme metabolism of bilirubin . . . . . . . . . . . . . . . 4

1.3 Stages of atherosclerotic lesions . . . . . . . . . . . . . . . . . . 9

1.4 Leucocytes attachment, rolling and migration through endothelial

cells . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 12

1.5 Stepwise NO synthesis by NOS . . . . . . . . . . . . . . . . . . 17

1.6 Schematic Presentation of Nitric Oxide isoforms structure . . . . 19

1.7 Steps in the inflammatory process . . . . . . . . . . . . . . . . . 29

1.8 Structure of the Selectin domains . . . . . . . . . . . . . . . . . . 31

1.9 Structure of ICAM-1 domains . . . . . . . . . . . . . . . . . . . 35

1.10 Structure of VCAM-1 different isoforms domanins . . . . . . . . 38

1.11 Activation of the cAMP-CREB signalling pathway . . . . . . . . 42

1.12 Schematic Presentation of NF-κB and IκB Structure . . . . . . . . 44

3.1 Morphology of H5V cells in vitro . . . . . . . . . . . . . . . . . . 54

3.2 Morphology of HUVEC cells in vitro . . . . . . . . . . . . . . . 55

3.3 Relationship of Bf-UCB with different albumin preparations . . . 56

3.4 Chemistry of the Griess Reagent . . . . . . . . . . . . . . . . . . 61

4.1 Effect of UCB on cell viability - MTT assay . . . . . . . . . . . . 72

4.2 Effect of different doses UCB on NO production . . . . . . . . . 74

4.3 TNF-α induces iNOS gene expression in H5V cells . . . . . . . . 76

4.4 Effect of UBC on TNF-α-induced iNOS gene - H5V cells . . . . . 77

4.5 NAC reverted TNF-α effects iNOS gene . . . . . . . . . . . . . . 79

4.6 Effect of NAC on NO production . . . . . . . . . . . . . . . . . 81

4.7 UBC and NAC reverted TNF-α induction of iNOS gene . . . . . . 82

ix

LIST OF FIGURES

4.8 TNF-α induces AM gene expression in H5V cells . . . . . . . . . 83

4.9 Effect of UBC on TNF-α-induced E-selectin gene - H5V cells . . 85

4.10 Effect of UBC on TNF-α-induced Vcam-1 gene - H5V cells . . . 86

4.11 Effect of UBC on TNF-α-induced Icam-1 gene - H5V cells . . . . 87

4.12 Effect of UBC on TNF-α-induced E-selectin gene - HUVEC cells 89

4.13 Effect of UBC on TNF-α-induced VCAM-1 gene - HUVEC cells 90

4.14 Effect of UBC on TNF-α-induced ICAM-1 gene - HUVEC cells . 91

4.15 TNF-α induces E-selectin protein expression in H5V cells . . . . 92

4.16 TNF-α induces Vcam-1 protein expression in H5V cells . . . . . . 93

4.17 TNF-α induces Icam-1 protein expression in H5V cells . . . . . . 94

4.18 Effect of UBC on TNF-α-induced AM protein expression - H5V

cells . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 95

4.19 PDTC inhibits AM and iNOS mRNA over-expression by TNF-α . 97

4.20 UCB and PDTC inhibit additively the gene over-expression . . . . 98

4.21 Induction of CREB phosphorylation by TNF-α in H5V cells . . . 99

4.22 UBC does not affect CREB phosphorylation in H5V cells . . . . . 100

4.23 UCB inhibits TNF-α-induced nuclear translocation of NF-κB . . . 101

x

List of Tables

1.1 NF-κB inhibitors that demonstrate anti inflammatory activity in

experimental models . . . . . . . . . . . . . . . . . . . . . . . . 48

3.1 H5V - Primer sequence designed for the mRNA quantification . . 63

3.2 HUVEC - Primer sequence designed for the mRNA quantification 64

3.3 Primary antibodies tested . . . . . . . . . . . . . . . . . . . . . . 65

4.1 Effect of UCB on cell viability - LDH release . . . . . . . . . . . 70

4.2 Effect of different doses of TNF-α on NO production . . . . . . . 71

4.3 Time dependent effect of TNF-α on NO production . . . . . . . . 73

4.4 Threshold cycle values of eNOS in HUVEC cells . . . . . . . . . 78

4.5 Threshold cycle values of genes studied in H5V control cells . . . 80

xi

ABSTRACT

Atherosclerosis, a progressive cardiovascular disease, is characterized by the ac-

cumulation of cholesterol in macrophage deposits (foam cells) and the formation

of atherosclerotic plaques in the walls large- and medium- sized arteries. The

earliest events in the development of atherosclerosis involve progressive modi-

fications in the endothelial micro-environment. This endothelial dysfunction is

a complex of multi-step mechanisms, for which reduced NO levels have been

reported as a marker, is characterized by increasing expression of adhesion mole-

cules (AMs), which mediate the diapedesis (migration) of inflammatory and im-

munocompetent cells through the endothelial layer into the arterial wall.

NO is synthesized intracellularly by nitric oxide enzymes (eNOS and iNOS)

and is regulated by a variety of stimuli. NO acts as an autocrine or paracrine

hormone, as well as intracellular messenger, with a critical role in vascular en-

dothelial growth factor-induced angiogenesis and vascular hyper-permeability in

vitro.

The over-expression of AMs is orchestrated by pro-inflammatory cytokines,

particularly TNF-α. The two major subsets of AMs participating in these pro-

cesses are the selectins, in particular E-selectin, and the immunoglobulin gene

superfamily, in particular vascular cell adhesion molecule 1 (VCAM-1) and inter-

cellular adhesion molecule 1 (ICAM-1).

Transcriptional regulation of these inflammatory genes requires the partici-

pation of several proteins, inducible activators, as: NF-κB and (CRE)-binding

protein (CREB). The most abundant form of NF-κB is an heterodimer of p50 and

xiii

Abstract

p65; which is sequestered in the cytoplasm in an inactive form through interac-

tion with the IκB inhibitor proteins. Signals that induce NF-κB release dimers

to enter to the nucleus and induce gene expression. Pyrridoline dithiocarbamate

(PDTC) a metal-chelating compound inhibits NF-κB by blocking ubiquitine lig-

ase activity towards phosphorylated IκB, in turn downregulating the expression

of E-selectin, VCAM-1 and ICAM-1. CREB is a widely expressed DNA-binding

protein, downstream target of cAMP, activated by phosphorylation on serine 133.

A regulatory site, on the gene promoters of both E-selectin and VCAM-1, binds

both NF-κB and CREB transcription factors.

Unconjugated bilirubin (UCB), long considered to be simply a waste end prod-

uct of heme metabolism and a marker for hepatobiliary disorders, is now thought

to function as an endogenous tissue protector by attenuating free radical-mediated

damage to both lipids and proteins. There is increasing epidemiological evidence

supporting an inverse association between cardiovascular disease and plasma lev-

els of bilirubin. Recent studies indicated that bilirubin may be protective in the

development of atherosclerotic diseases by inhibiting the proliferation of vascular

smooth muscle cells by mechanisms yet to be established. It has been proposed

that UCB can interfere with the atherosclerotic disease development by inhibiting

the trans-endothelial vascular cell adhesion molecule (VCAM-1)-dependent mi-

gration of monocytes into the intima. The aim of this study is to investigate the

effect of the UCB in the endothelial dysfunction. Specifically UCB effects on NO

production, AMs expression and the regulatory transcription factors involve in the

inflammatory response.

Variable doses of free bilirubin (Bf) (the active form of UCB in plasma), sim-

ulating upper normal (15 nM) and modestly elevated levels (30 nM) for plasma,

were evaluated in two models of endothelial cells. A) H5V, murine microvascular

endothelial cell line, and B) HUVEC (Human Umbilical Vein Endothelial Cells),

isolated from the vein of human umbilical cord. TNF-α (20 ng/mL) was added in

order to reproduce, in vitro, the endothelial dysfunction and describe UCB contri-

bution on its effects.

xiv

UCB alone reduced the viability in H5V cells by MTT assay in a dose depen-

dent manner after 24 hours while no effect was observed in the LDH released.

In the first set of experiments NO production in H5V cells was evaluated, a

time-depended increase on NO basal and a dose-dependent decrease on NO con-

centration after TNF-α (20 ng/mL) were observed. NO reduction related TNF-α

was seen at all times studied. The effect of UCB was studied in co-treatments

with TNF-α for 24 and 48 hours. UCB (Bf 15 and 30 nM) significantly reversed

the reduction of nitrite content induced by TNF-α at 48 hours.

The gene expression analysis was performed by Real Time PCR technology

with specific primers for eNOS, iNOS, E-selectin, VCAM-1 and ICAM-1. In H5V

cells, TNF-α increased the expression of all the genes studied (except eNOS) at

2, 6 and 24 hours. The co-treatment with UCB , at a Bf that did not themselves

affect the expression of the three adhesion molecules, blunts the over-expression

of E-selectin, Vcam-1 and iNOS induced by a pro-inflammatory cytokine such as

TNF-α. The inhibitory effect of UCB was usually modest (20-30%) and detected

at 2 and/or 6 hours, but had disappeared 24 hours. Furthermore, a synergistic ef-

fect between TNF-α and UCB was seen on the expression of iNOS at 24 hours,

indicating a biphasic regulation. Moreover, no effects were seen on eNOS. Simi-

lar results were observed in the regulation of the gene expression of the AMs and

viability in HUVEC cells, indicating the lack of species specific effect. However,

no effect of TNF-α or UCB was seen in the expression of iNOS, eNOS or NO

content.

Western blot analysis in H5V cells confirmed that TNF-α induced the expres-

sion of E-selectin, VCAM-1 and ICAM-1 in a time-dependent manner. This effect

was blunted after 24 hours by the presence of UCB (Bf 15 and 30 nM).

The contribution of NF-κB pathway in UCB effects was investigated by ad-

dition of a specific inhibitor, PDTC. The co-treatment with PDTC and UCB for

2 hours produced an additive reduction of TNF-α effect on E-selectin, VCAM-1,

and iNOS in H5V cells. In addition, UCB prevented the nuclear translocation of

xv

Abstract

NF-κB induced by TNF-α. Failure of UCB to alter TNF-α-induced phosphoryla-

tion of CREB (at Ser 133) suggested that the CREB pathway was not involved in

the UCB inhibition.

The results obtained in the present study shows that unconjugated bilirubin,

even at upper-normal physiological (15 nM) and mildly elevated (30 nM) Bf can

modulate gene expression and endothelial cell function. Furthermore, UCB may

regulate NO levels by a bi-phasic regulation of iNOS, and in addition influences

the expression of the endothelial adhesion molecules. In summary, these data in-

dicates that bilirubin limits the over-expression of the adhesion molecules and reg-

ulates the NO metabolism in the pro-inflammatory state induced by the cytokine

TNF-α. Even though UCB alone does not alter these markers. UCB effects are

mediated in part by a modulation of the NF-κB transcription factor. These results

support the concept that modestly elevated concentrations of bilirubin may help

prevent atherosclerotic disease as suggested by epidemiological studies.

xvi

PUBLICATIONS

List of Publications relevant to the Thesis

• Multidrug resistance associated protein 1 protects against

bilirubin-induced cytotoxicity. Calligaris S, Cekic D, Roca-Burgos L,

Gerin F, Mazzone G, Ostrow JD, Tiribelli C.FEBS Lett. 2006 Feb 20;

580(5): 1355-9. Epub 2006 Jan 26.

• Unconjugated bilirubin prevents the TNF-α related induction of three

endothelial adhesion molecules via the NF-κB pathway. Mazzone G,

Rigato I, Ostrow DJ, Bortoluzzi A and Tiribelli C. Submitted.

List of other Publications

• FSH and bFGF stimulate the production of glutathione in cultured rat

Sertoli cells. Gualtieri AF, Mazzone GL, Rey RA, Schteingart HF.Int J

Androl. 2007 Nov 26; [Epub ahead of print.]

xvii

ABBREVIATIONS

List of abbreviations

AM Adhesion Molecules

VCAM-1 Human Vascular Cell Adhesion Molecule-1

Vcam-1 Mouse Vascular Cell Adhesion Molecule-1

ICAM-1 Human Intercellular Adhesion Molecule-1

Icam-1 Mouse Intercellular Adhesion Molecule-1

E-selectin Human or Mouse Endothelial Selectin

TNF-α Tumor Necrosis Factor alpha

IL Interleukin

IFN Interferons

TNF-R55/RI TNF-α Receptor I

TNF-R75/RII TNF-α Receptor II

UCB Unconjugated Bilirubin

Bf Free Unbound Plasma Bilirubin

HO1 Heme Oxygenase-1



UGT/UGT1A1 Diphosphoglucuronate Glucoronosyltransferase

UDPGA UDP-glucuronic Acid

BVR Biliverdin Reductase

cMOATP Canalicular Multispecific Anion Transporter

xix

Abbreviations

ATP Adenosine Triphosphate

NO Nitric Oxide

NOS Nitric Oxide Synthase

eNOS Endothelial Nitric Oxide Synthase

iNOS Inducible Nitric Oxide Synthase

CREB cAMP-response Element(CRE)-binding Protein

NF-κB Nuclear Factor κB

STAT Signal Transducers and Activators of Transcription

CBP cAMP-responsive Element(CREB)-binding Protein

IκB Inhibitory Protein of NF-κB

ATF Activating Transcription Factor (ATF)-binding Element

AP-1 Activator Protein-1

C/EBP CCAAT/enhancer Binding Protein

MAPK Mitogen-activated Protein Kinase

GATA Globin Transcription Factor

NF-1 Nuclear Factor I/C (CCAAT-binding transcription factor)

GAS IFN-gamma-activating sites

ISRE Interferon-stimulated Response Element

IRF-E Interferon Regulatory Factor Binding site

NAC N-acetylcysteine

PDTC Pyrrolidine Dithiocarbamate

ROS Reactive Oxygen Species

LPS Lipopolysaccharide

GSH Glutathione

ECM Extracellular Matrix

HUVEC Human Umbilical Vein Endothelial Cells

H5V Murine Microvascular Endothelial Cells

LDH Lactate Dehydrogenase

NO–2 Nitrite

NO–3 Nitrate

xx

Chapter 1

INTRODUCTION

1.1 Bilirubin metabolism

Bilirubin is produced as the end product of the degradation of hemoglobin from

senescent or hemolyzed red blood cells. The breakdown of hemoglobin, other

hemoproteins, and free heme generates 250 to 400 mg of bilirubin daily in hu-

mans (London et al., 1950). A number of studies indicate that hemoglobin is the

principal source of bile pigment in mammals, accounting normally for approx-

imately 80% of daily bilirubin production (London et al., 1950; Ostrow et al.,

1962).

The heme degradation is enzymatic, mediated by the microsomal enzyme

heme oxygenase 1 (HO-1), which directs stereospecific cleavage of the heme

ring. This reaction requires a reducing agent, such as nicotinamide-adenine din-

ucleotide phosphate (NADPH) and three molecules of oxygen, and results in the

formation of the linear tetrapyrrole, biliverdin, carbon monoxide, and iron (Ten-

hunen et al., 1968). Three isoforms of HO have been described: two constitutively

expressed isoforms, HO-2 and HO-3 (Rublevskaya & Maines, 1994; McCoubrey

et al., 1997), and a inducible isoform, HO-1 (Elbirt & Bonkovsky, 1999). HO-1,

the rate-limiting enzyme in the catabolism of the heme, is ubiquitous and is tran-

scriptionally inducible by a variety of agents, such as heme, oxidants, hypoxia,

endotoxin, and cytokines (Maines, 1997; Ishizawa et al., 1983). Following its

synthesis by HO1 or HO2, biliverdin is converted to bilirubin by the phosphopro-

tein biliverdin reductase (BVR), in the presence of NADPH (Figure 1.1).

1

Introduction

Figure 1.1: Bilirubin metabolism. Bilirubin derives from heme metabolism by heme oxyge-nase and biliverdin reductase.

Bilirubin is tightly, but reversibly, bound to plasma albumin. Albumin binding

keeps bilirubin in solution and transports the pigment to different organs and to

the liver in particular. Albumin binding protects against toxic effects of bilirubin.

A small unbound fraction of bilirubin is thought to be responsible for its biologi-

cal effects (Weisiger et al., 2001; Ahlfors, 2001; Wennberg et al., 1979).

At the sinusoidal surface of the hepatocyte, bilirubin dissociates from albumin

and is uptaken by hepatocyte, through mechanism not fully elucidated (Zucker

2

1.2 Bilirubin and pathophysiology

et al., 1999; Cui et al., 2001). Within the hepatocyte, bilirubin binds to a group

of cytosolic proteins, mainly to glutathione-S-transferases (GSTs) (Zucker et al.,

1995). GST binding inhibits the efflux of bilirubin from the cell (Figure 1.2).

A specific form of uridine diphosphoglucuronate glucoronosyltransferase (UGT,

also termed UGT1A1), located in the reticulum, catalyzes the transfer of the glu-

curonic acid moiety from UDP-glucuronic acid (UDPGA) to bilirubin. In these

step bilirubin diglucuronide and monoglucuronide is formed (Bosma et al., 1994;

Hauser et al., 1984). This conversion is critical for efficient excretion of biliru-

bin to the bile canaliculus. Conjugated bilirubin is excreted against concentration

gradient by a canalicular multispecific anion transporter (cMOAT) also known

as multidrug resistance-related protein (MRP2) (Kamisako et al., 1999). The

energy for the transport is provided by the hydrolysis of an adenosine triphos-

phate (ATP). Any abnormality causing slowing or blockage of this rather compli-

cated metabolic pathway will lead to disturbances of bilirubin metabolism (Os-

trow et al., 2003a).


Bilirubin has been implicated in the development of different diseases (Green-

berg, 2002). Is well known that it is responsible for the yellow skin coloration in

physiological jaundice of the newborn (Gourley, 1997). In this case, jaundice is

the result of a combination of factors, such as the increased bilirubin production

and immaturity of the bilirubin disposal mechanism of the liver. In the great ma-

jority of the cases, neonatal hyperbilirubinemia is innocuous. But severe neonatal

hyperbilirubinaemia, in few cases, may cause kernicterus and ultimately death.

Kernicterus is a devastating, chronic, disabling neurological disorder (Shapiro,

2003). Furthermore, unconjugated hyperbilirubinemia is observed also as a con-

sequence of mutations on UGT1A1 gene, leading the description of Crigle-Najjar

and Gilbert syndromes and in the hemolytic disorders (Bosma, 2003; Ostrow &

Tiribelli, 2001a).

Particularly, the kernicterus is an example that suggests the cytotoxic effect

3

Introduction

Figure 1.2: Summary of hepatic metabolism of bilirubin. Bilirubin is strongly bound to al-bumin in the circulation. At the sinusoidal surface of the hepatocyte, this complex dissociates,and the bilirubin enters hepatocytes. Within the hepatocyte, bilirubin binds to glutathione-S-transferases (GSTs). UGT1A1 (or UGT) catalyzes the transfer of the glucuronic acid formingthe diglucuronide and monoglucuronide forms. Canalicular excretion of bilirubin is mediated bymultidrug resistance related protein (MRP2).

4


of bilirubin. Several studies have shown such toxicity (Hansen, 2001; Ostrow &

Tiribelli, 2001b), which typically occurs at micromolar concentrations of biliru-

bin. In vitro studies demonstrated that bilirubin causes death of cultured neurons

(Rodrigues et al., 2002a) and cerebral microvascular endothelial cells (Akin et al.,

2002) by apoptotic pathways. N-methyl-D-aspartate receptor antagonists can pro-

tect cultured neurons from bilirubin toxicity (Grojean et al., 2000), suggests the

implications of this class of glutamate receptors in pathogenesis of bilirubin dam-

age.

However, accumulating evidence points to a protective role of bilirubin at

physiologic levels (Dor et al., 1999; Tomaro & Batlle, 2002). Stocker et al.

(Stocker et al., 1987; Stocker & Peterhans, 1989) showed that bilirubin is an an-

tioxidant that can scavenge peroxyl radicals. Furthermore, bilirubin has been re-

ported to protect against a variety of pathological processes, including complement-

mediated anaphylaxis (Nakagami et al., 1993), myocardial ischemia (Clark et al.,

2000), pulmonary fibrosis (Wang et al., 2002), and cyclosporine nephrotoxicity

(Polte et al., 2002).

This raises a seeming paradox: how can such low concentrations of UCB

protect against the much higher levels of reactive oxygen species? (Ostrow &

Tiribelli, 2003). One possible explanation involves the mechanism of redox cy-

cling. Biliverdin is reduced to bilirubin through the action of BVR. Bilirubin then

interacts with reactive oxygen species (ROS), which neutralize their toxicity and

oxidize bilirubin, thereby regenerating biliverdin. As this cycle is repeated, the

antioxidant effect of bilirubin is multiplied. In this manner, low concentrations

of bilirubin can be recycled to neutralize large amounts of ROS (Baranano et al.,

2002).

There is increasing epidemiological evidence supporting an inverse associ-

ation between cardiovascular disease and plasma bilirubin levels (Rigato et al.,

2005). In a study involving 4156 individuals aged 5-30 years from a biracial

(black-white) community, bilirubin levels showed significant differences related

to races and sex. In males of both races the bilirubin level was higher than their

5

Introduction

counterparts, except in the pre-adolescents age group of 5-10 years. However,

males in general have higher risk for cardiovascular diseases than females. This

apparent paradox may be due to the multifactorial nature of cardiovascular disease

(Madhavan et al., 1997).

Similarly, a cross-sectional prevalence study conducted on men aged 21 to 61

years found that the decrease in total serum bilirubin was associated with more

severe cardiovascular events (Schwertner et al., 1994).

Interestingly, the prospective Farmingham offspring study found that a higher

total serum bilirubin level was associated with a lower risk for myocardial infrac-

tion, coronary artery disease and any adverse cardiovascular events, particulary

in men (Djouss et al., 2001). It is not clear whether higher serum bilirubin con-

centrations in physiological ranges work in favor of the cardiovascular system in

younger persons with no cardiovascular risk factors (Breimer et al., 1994). Fur-

thermore, another study demonstrated that patients with Gilbert syndrome (who

have mildly elevated bilirubin levels) have less ischemic heart disease than the

general population (Vitek et al., 2002).

On the contrary, in another study conducted on 7735 men, ages 40-59, in Eng-

land, Wales and Scotland, it was demonstrated that low bilirubin concentration

is also strongly associated with several cardiovascular risk factors. Men with in-

creased concentrations of serum bilirubin and liver enzymes appeared to be at

much increased risk of ischemic heart disease. Interestingly, after adjustment

for lifestyle factors, biological factors, and preexisting disease, the relationship

remained U-shaped. This analysis demonstrate that both low and high concen-

trations of serum bilirubin are associated with an increased risk of ischemic heart

disease (Breimer et al., 1995). However, Hopkins et al. (Hopkins et al., 1996)

demonstrated that significant lower levels of bilirubin were found in patients with

coronary artery disease.

The relevance of serum bilirubin as a risk factor inversely related to the coro-

nary artery disease was suggested also in other studies (Gullu et al., 2005). How-

6

1.3 Vascular atherosclerosis

ever bilirubin correlation as a useful marker compared with others (such as apo-

lipoprotein B) seems to be controversial (Levinson, 1997).

More recent studies indicated that bilirubin may be protective in the develop-

ment of atherosclerotic diseases by inhibiting the proliferation of vascular smooth

muscle cells by mechanisms not well established yet (Stocker & Keaney, 2004).

Collectively, these data indicate that the relationship between UCB and coronary

heart disease is still to be elucidated.


Atherosclerosis is the major source of morbidity and mortality in the developed

world (Murray & Lopez, 1997). The magnitude of this problem is profound, as

atherosclerosis claims more lives than all types of cancer combined and the eco-

nomic costs are considerable. Although currently a problem of the developed

world, the World Health Organization predicts that global economic prosperity

could lead to an epidemic of atherosclerosis as developing countries acquire West-

ern habits.

The vascular atherosclerosis, a progressive cardiovascular disease, is charac-

terized by the accumulation of cholesterol in macrophage deposits (foam cell) in

large- and medium- sized arteries and the formation of the so called atheroscle-

rotic plaques in the arteries walls (Stocker & Keaney, 2004). Several clinical

studies provide important evidence between traditional risk factors (dyslipidemia,

hypertension, diabetes, obesity, among others) associated with atheromatous dis-

ease (Stocker & Keaney, 2004; Libby et al., 2002).

1.3.1 Morphology of atherosclerotic lesions

The arterial wall normally consists of three well-defined concentric layers that

surround the arterial lumen, each of which has a distinctive composition of cells

7

Introduction

and extracellular matrix. The layer immediately adjacent to the lumen is called the

intima, the middle layer is known as the media, and the outermost layer comprises

the arterial adventitia. These three layers are demarcated by concentric layers of

elastin, known as the internal elastic lamina that separates the intima from the me-

dia, and the external elastic lamina that separates the media from the adventitia.

A single contiguous layer of endothelial cells lines the luminal surface of arteries.

These cells sit on a basement membrane of extracellular matrix and proteoglycans

that is bordered by the internal elastic lamina. Although smooth muscle cells are

occasionally found in the intima, endothelial cells are the principal cellular com-

ponent of this anatomic layer and form a physical and functional barrier between

flowing blood and the stroma of the arterial wall.

Atherosclerosis manifests itself histological as arterial lesions known as plaques

that have been extensively characterized into six major types of lesions that reflect

the early, developing, and mature stages of the disease (Stary et al., 1995; Stary

et al., 1994). The lesions stages were described as:

• Type I lesions, represent the very initial changes and are recognized as

an increase in the number of intimal macrophages and the appearance of

macrophages filled with lipid droplets (foam cells);

• Type II lesions, include the fatty streak lesion, the first grossly visible lesion,

and are characterized by layers of macrophage foam cells and lipid droplets

within intimal smooth muscle cells and minimal coarse-grained particles

and heterogeneous droplets of extracellular lipid;

• Type III (intermediate) lesions, are the morphological and chemical bridge

between type II and advanced lesions. Type III lesions appear in some adap-

tive intimal thickening (progression-prone locations) in young adults and

are characterized by pools of extracellular lipid in addition to all the com-

ponents of type II lesions;

• Type IV lesions, are defined by a relatively thin tissue separation of the lipid

core from the arterial lumen. Type V lesions exhibit fibrous thickening of

8


Figure 1.3: Stages of atherosclerotic lesion. Varying stages of atherosclerotic lesion as outlineby Stary et al. From (Stocker & Keaney, 2004)

this structure, also known as the lesion cap. These type IV and V lesions

can be found initially in areas of the coronary arteries, abdominal aorta, and

some aspects of the carotid arteries in the third to fourth decade of life;

• Mature type VI lesions exhibit architecture that is more complicated and

characterized by calcified fibrous areas with visible ulceration. These types

of lesions are often associated with symptoms or arterial embolization.

In summary, the cohort studies by Stary show that progression beyond the fatty

streak stage is associated with a sequence of changes starting with the appearance

of extracellular lipid which begins to form a core to a lesion that is becoming more

9

Introduction

elevated (Figure 1.3). Smooth muscle cells migrate into and proliferate within the

plaque, forming a layer over the luminal side of the lipid core. More and more

collagen is produced and plaque size increases. The process culminates in what is

known as a raised fibrolipid or advanced plaque. In the aorta such plaques may be

a centimeter or more in length.

1.3.2 Atherogenesis - Response to the injury theory

Over the past 150 years, numerous efforts have been made to explain the com-

plex events associated with the development of atherosclerosis. In this endeavor,

different hypothesis have emerged that emphasize different concepts as the neces-

sary and sufficient events to support the development of the atherosclerosis lesions

(Stocker & Keaney, 2004).

These paradigms have been devoted to understand the molecular mechanisms

of atherosclerosis and the factors that predispose individuals to clinical events.

Ross et al. (Ross, 1999) proposed “the response to the injury” theory of athero-

sclerosis. In this hypothesis, the initial step in the atherogenesis is the endothelial

denudation leading to a number of compensatory responses that alter the normal

vascular homeostatic properties (Ross, 1999).

The earliest event that occurs in the development of atherosclerosis is char-

acterized by a progressive modification in the physiological microenvironment

identified as endothelial dysfunction (Endemann & Schiffrin, 2004).

The endothelial dysfunction is a complex multi-step mechanisms that has been

implicated in the pathophysiology of different forms of cardiovascular disease

(Gimbrone et al., 1995). The endothelial injury or dysfunction is characterized by

enhanced endothelial permeability and low-density lipoprotein (LDL) retention

in the subendothelial space (Schwenke & Carew, 1989; Schwenke & Zilversmit,

1989). This event is followed by leukocyte adhesion and transmigration across

the endothelium (Petri & Bixel, 2006)(Figure 1.4).

10


In intermediate stages, atherosclerosis is characterized by foam cell formation

(macrophages filled with lipid droplets) and an inflammatory response including

T-cell activation, the adherence and aggregation of platelets and further entry of

leukocytes into the arterial wall along with migration of smooth muscle cells into

the intima (Bobryshev, 2006; Zernecke & Weber, 2005; Raines & Ross, 1993).

The oxidized lipids deposition leads to a cell proliferation within the arterial wall

that gradually impinges on the vessel lumen and impedes blood flow (Libby &

Aikawa, 2001).

Continued inflammation allows for cellular necrosis, with a concomitant re-

lease of cytokines, growth factors that set the stage for autocatalytic expansion of

the lesion (Raines & Ross, 1995). Finally, advanced atherosclerosis is character-

ized by continued macrophage accumulation, fibrous cap formation, and necro-

sis in the core of the lesion (Davies & Woolf, 1993; Bobryshev, 2006; Libby

& Aikawa, 2001). This process may be quite insidious lasting for decades until

an atherosclerotic lesion (plaque) becomes disrupted and deep arterial wall com-

ponents are exposed to flowing blood, leading to thrombosis and compromised

oxygen supply to target organs such as the heart and brain (Libby, 2002; Davies

& Woolf, 1993).

Because of the silent and slow progression of atherosclerosis in humans, many

of the current concepts on the cellular and molecular mechanisms involved in the

formation and alteration of advanced lesions of atherosclerosis have come from

animal models.

1.3.3 Endothelium

The endothelium is strategically located between the wall of blood vessels and

the blood stream. Endothelial cells regulate a wide array of processes including

thrombosis, vascular tone, and leukocyte trafficking (Cook-Mills & Deem, 2005;

Zeiher, 1996). It senses mechanical stimuli such as pressure and shear stress, and

11

Introduction

Figure 1.4: Attachment, rolling and migration of leucocytes through the arterial endothe-lial monolayer into the intima. In the human arterial intima, the majority of monocytes differenti-ate into macrophages but some differentiate into dendritic cells (A). The majority of macrophagestransform into foam cells (B), while others do not accumulate lipids in their cytoplasm (C). Non-foam macrophages frequently contact other immuno-inflammatory cells (C). In (C), a non-foammacrophage is marked by a black star, while white stars indicate lymphocytes. Transmission elec-tron microscopy. Scale bars: 4 mm (B, C). From (Bobryshev, 2006)

12


hormonal stimuli, such as vasoactive substances (Galley & Webster, 2004; Cines

et al., 1998).

One of the most important vasodilating substances released by the endothe-

lium is nitric oxide (NO)(Mann et al., 2003), which inhibits cell growth and

inflammation and has anti-aggregant effects on platelets (Bruch-Gerharz et al.,

1998). Reduced NO levels have often been reported in presence of impaired en-

dothelial function (Endemann & Schiffrin, 2004). Different mechanisms may be

involved in the onset of this dysfunction:

1. reduced expression and/or functionality of nitric oxide synthase (Cai & Har-

rison, 2000);

2. shortage of co-substrates (Mann et al., 2003);

3. NO consumption by increased ROS production (Cai & Harrison, 2000; Fis-

cher et al., 2003).

NO plays a pivotal role in anti-atherogenesis; in addition to being a vasodila-

tor, it inhibits platelet adherence and aggregation, smooth muscle cells prolifer-

ation, and endothelial cell leukocyte interaction, all of which are key events in

atherogenesis (Cooke et al., 1992; Davignon & Ganz, 2004). Pathophysiological

states associated with a decrease in NO bio-availability and endothelial adhesion

molecules for monocytes are up-regulated (Caterina et al., 1995). This could en-

hance local inflammation of the vessel wall, which may play a critical role in

plaque rupture (van der Wal et al., 1994).

The endothelial dysfunction is an early event, characterize by markers of in-

flammation and endothelial activation. These markers become useful, by provid-

ing additional information about a patient’s risk of developing cardiovascular dis-

ease, as well as providing new targets for treatment (Endemann & Schiffrin, 2004;

Tardif et al., 2006). Moreover, the endothelial dysfunction may also precede the

development of other diseases not strictly associated cardiovascular disease (En-

gler et al., 2003; Raitakari et al., 2004; Virdis et al., 2001).

13

Introduction

Clearly, understanding the mechanisms and mediators of endothelial dysregu-

lation and inflammation may yield new targets to predict, prevent, and treat car-

diovascular disease. Markers of endothelial dysfunction include soluble forms

of adhesion molecules, which can be assessed in plasma (Szmitko et al., 2003b).

However, several other markers such us oxidized low-density lipoprotein receptor-

1 (LOX-1), CD40 ligand, asymmetric dimethylarginine (ADMA), to name a few,

have been proposed (Castelli et al., 1986; Szmitko et al., 2003a).

In summary, the endothelium is a crucial vascular structure not only because

it serves as a barrier between flowing blood and vascular wall but also because

it produces mediators regulating vascular growth, platelet function, and coagula-

tion. Thus, the endothelium is not only target but also mediator of inflammatory

diseases.

1.4 Pro-inflammatory cytokines

Cytokines and growth factors constitute a potent set of multi-functional peptide

signalling molecules capable of regulating several cellular functions, including

chemotaxis or directed migration, proliferation, accumulation of lipid, and syn-

thesis of matrix components all of which take place during atherogenesis.

Cytokine is the term that has been used to describe the family of peptides that

regulate immune function and the term growth factor has most often been applied

to stimulators and inhibitors of cell proliferation. These growth regulatory mol-

ecules are multi-functional and a single peptide can promote cellular changes at

several different levels (Nathan & Sporn, 1991).

In vivo, growth factors, cytokines and their specific cell-surface receptors are

expressed at low or undetectable levels, may be sequestered in inactive forms and

may be regulated differentially after activation. By binding to specific cell-surface

receptors on responsive cells, cytokines and growth factors may induce signals

that evoke a large number of biological responses (Nathan & Sporn, 1991).

14

1.4 Pro-inflammatory cytokines

Cytokines appear to orchestrate the chronic development of atherosclerosis by

mediating infiltration and accumulation of immunocompetent cells, or enhancing

foam cell formation and thrombogenicity of the lipid core. Several studies have

examined the expression of the various cytokines and growth factors that may be

involved in the cellular changes that accompany developing lesions. Increased

concentrations of IL-1, TNF-α, IFN-γ, and platelet-derived growth factor (PDGF)

have been observed in the lesions of atherosclerosis (Raines & Ross, 1993).

Pro-inflammatory cytokines, as TNF-α, increase leukocyte adhesion to culture

endothelium via the expression of adhesion molecules (AM) and the release of

chemokines, facilitating the attraction and diapedesis of immunocompetent cells

in vitro (Young et al., 2002).

In 1975, Lloyd et al. could demonstrated unambiguously that treatment of

mice or rabbit with bacille Calmette-Gurin (BCG) for 10-14 days, followed by

injection of lipopolysaccharide (LPS), led to the released into the circulation of

a protein, which they called Tumor Necrosis Factor or TNF-α (Carswell et al.,

1975).

On the basis of amino acid sequences data derived from purified human or rab-

bit TNF-α, different groups cloned the human TNF-α (hTNF) cDNA gene (Shirai

et al., 1985; Pennica et al., 1984). Subsequently, the cDNA from pig, cow, rabbit,

cat, rat and mouse have been reported (McGraw et al., 1990; Drews et al., 1990).

Both human and the murine cDNA could be expressed at very high efficiency in

Escherichia coli and became available for physico-chemical, biological, biochem-

ical and preclinical research, as well as for clinical application.

The human genomic TNF-α gene is located on the short chromosome 6 and

the gene is interrupted by three introns. The TNF-α cDNA gene codes for a ma-

ture polypeptide of 157 amino acids in human and 156 amino acids in mouse

(Fiers, 1991). Interestingly, the polypeptide is preceded by a 76 amino acid long

pre-sequence that is much longer than a classical signal sequence. Furthermore, is

15

Introduction

strongly conserved between different mammalian species as the mature sequence,

which suggest a specific and essential function. The native structure of TNF-α is a

trimmer with a total molecular mass of 52 kDa (Van et al., 1991). Unlike human,

mouse TNF-α (mTNF) is a glycoprotein.

TNF-α was originally thought to be produced exclusively by macrophages.

However, by immunohistochemistry and in situ hybridization was also detected in

mesenchymal, endothelial and smooth muscle cells of the atherosclerotic human

arteries (Barath et al., 1990).

Receptors for TNF-α are expressed in the majority of mouse and human cell

lines. The number of receptors vary from about 200 up to 10000, and the binding

constant is around 2X10−10 M. Although the presence of the TNF-α receptor is a

prerequisite for the biological effect, there is not correlation between the number

of receptors and the magnitude of the response, or even the direction of response.

Two distinct TNF-α receptor subtypes (type I and type II) have been identified.

The first TNF-α receptor has a molecular weight of about 55 kDa, and can be re-

ferred to as TNF-R55 or TNF-RI. The second receptor has a molecular weight of

about 75 kDa, and can be referred to as TNF-R75 or TNF-RII. Although both re-

ceptors bind TNF-α, different cellular responses can be activated (Fiers, 1991).

TNF-α has numerous biological functions, including hemorrhagic necrosis of

transplanted tumors, cytotoxicity, and an important role in endotoxic shock and

in inflammatory, immunoregulatory, proliferative, and antiviral responses (Cler-

mont et al., 2003; Fiers, 1991).

1.5 Nitric oxide

The Nitric Oxide (NO), a diatomic radical, was originally recognized in connec-

tion with contraction and relaxation of blood vessels. In the meantime, it has

become clear that NO is an universal messenger substance that takes part in di-

verse forms of intercellular and intracellular communication. For example, NO is

formed with the help of specific enzymes systems activated by extracellular and

16

1.5 Nitric oxide

Figure 1.5: Stepwise NO synthesis by NOS. The two reactions of NO synthesis as catalyzedby NOS. The NADPH and oxygen requirements of each reaction are shown.

intracellular signals (Lowenstein & Snyder, 1992). Indeed, NO is synthesized

intracellularly and reaches its effector molecules, which may be localized in the

same cell or in neighboring cells, by diffusion. Finally, NO is notable among

signals for its rapid diffusion, ability to permeate cell membranes, and intrinsic

instability, properties that eliminate the need for extracellular NO receptors or

targeted NO degradation (Nathan, 2003). Thus, NO has the character of an au-

tocrine or paracrine hormone, as well as intracellular messenger (Bruch-Gerharz

et al., 1998). One way or another, practically every cell in mammals is subject to

regulation by NO.

1.5.1 Biosynthesis of nitric oxide

The NO is generated by the oxidation of L-arginine to citrulline exclusively by

the enzyme Nitric Oxide Synthase (NOS). NO is synthesized from L-arginine

through a five-electron oxidation step via the formation of the intermediate NG-

hydroxy-L-arginine (Hibbs et al., 1988; Palmer et al., 1988). Others substrates

for NOS-mediated NO production are the molecular oxygen and NADPH (Leone

et al., 1991)(Figure 1.5).

The NOS are enzymes of complex composition that are active as dimers but

17

Introduction

can also exist as inactive monomers. Furthermore, three isoforms of NOS have

been identified (Moncada et al., 1991; Forstermann et al., 1998; Stuehr & Griffith,

1992). Two isoforms are constitutively expressed and are activated by Ca+2 intra-

cellular levels (Nathan, 1992).

Among them, nNOS (NOS1) was found to have a widespread distribution in

specific neurons of the central and peripheral nervous system (Bredt et al., 1991;

Vincent & Kimura, 1992; Vincent & Hope, 1992). However, nNOS expression

is not confined to neuronal cells (Forstermann et al., 1998). eNOS (NOS3) was

first identified in endothelial cells (Frstermann et al., 1991), but the expression

has also been demonstrated in several nonendothelial cell types, including neu-

rons and other rat brain regions (Abe et al., 1997; Dinerman et al., 1994), cardiac

myocyte (Balligand et al., 1995), blood platelets (Sase & Michel, 1995), hepa-

tocyte (Zimmermann et al., 1996), smooth muscle cells (Teng et al., 1998) and

others (Forstermann et al., 1998). The third isoform is a calcium independent,

iNOS (NOS2) and is not constitutive expressed (Nathan, 1992) but is induced

in macropahges, as well as in others cells such as melanocytes (Fecker et al.,

2002), cardiac myocytes (Kacimi et al., 1997), hepatocytes (Moreau, 2002), rabbit

corneal epithelial, stroma and endothelial cells (O’Brien et al., 2001) in response

to cytokines and bacterial endotoxin .

NOS isoforms are highly homologous in their primary structure (Figure 1.6).

They differ in size (130 to 160 kDa), amino acid sequence (50 to 60% identity be-

tween any two isoforms) (Lamas et al., 1992), tissue distribution, transcriptional

regulation, and activation by intracellular calcium. Moreover, they share an over-

all three-component construction (Crane et al., 1997; Stuehr et al., 2001; Moncada

& Higgs, 1993):

• an NH2-terminal catalytic oxygenase domain (residues 1 to 498 for iNOS)

that binds heme (iron protoporphyrin IX), BH4 , and the substrate L-Arginine;

• a COOH-terminal reductase domain (residues 531 to 1144 for iNOS) that

binds FMN, FAD, and NADPH;

18

1.5 Nitric oxide

Figure 1.6: Schematic Presentation of Nitric Oxide isoforms structure. eNOS and iNOS dif-fentes domains and homology regions. For eNOS, regions involved in acylation, binding of sub-strates and cofactors are indicated as well as the oxygenase and reductase domain. Arg, arginine;BH4, tetrahydrobiopterin; CaM, calmodulin; FMN, flavin mononucleotide; FAD, flavin adeninedinucleotide.

• an intervening calmodulin-binding region (residues 499 to 530 for iNOS)

that regulates electronic communication between oxygenase and reductase

domains.

Although NO synthesis reaction by NOS is well understood, some aspects

have been question and still been controversial (Alderton et al., 2001). It is

well accepted that the biosynthesis of NO requires a number of essential cofac-

tors such as tetrahydrobiopterin (BH4), flavin adenine dinucleotide (FAD), and

flavin mononucleotide (FMN). BH4 seems to be important in maintaining NOS

in its active dimeric form (Griffith & Stuehr, 1995). Furthermore, NOS contains

binding sites for heme and calmodulin, both being essential for the enzyme ac-

tivity. Indeed, functionally and structurally NOS enzymes catalase, as expected,

19

Introduction

a multi-electron transfer in order to generate NO. The FAD and FMN in the re-

ductase domain accept electrons from NADPH and pass them on to the haem

domain. The essential role of the flavin cofactors is to allow a two-electron donor

(NADPH) to donate electrons to a one-electron acceptor (haem), by forming a

stable semiquinone radical intermediate (NG-hydroxy-L-arginine). These elec-

tron flow may result in the formation of the enzyme products citrulline and NO

(Abu-Soud & Stuehr, 1993).

Intriguingly the pathway of electron flow appears to cross over between differ-

ent subunits of the dimer, i.e. the flavin domain of one polypeptide chain donates

its electron to the haem domain of the other. The physiological reason for this is

unclear, but it is clearly a major reason why the NOS monomer is inactive.

1.5.2 Endothelial Nitric Oxide Synthase (eNOS)

Regulation of eNOS expression

The eNOS promoter has been cloned from human (Marsden et al., 1993), bovine

(Venema et al., 1994), murine (Gnanapandithen et al., 1996), porcine (Zhang et al.,

1997) endothelial cells, and there is a high degree of homology in the promoter

sequence among the different species (Venema et al., 1994). This high sequence

homology suggests significant evolutionary conservation of transcriptional regu-

lation. Like many so-called constitutively expressed proteins, the eNOS promoter

lacks a typical TATA box (Forstermann et al., 1998). In addition, eNOS promoter

possesses multiple potential cis-regulatory DNA sequences, including a CCAT

box, Sp1 sites, GATA motifs, CACCC boxes, AP-1 and AP-2 sites, a p53 bind-

ing region, NF-1 elements, NF-κB site, acute phase reactant regulatory elements,

sterol regulatory elements, and shear stress response elements (Marsden et al.,

1993; Cieslik et al., 1998; Karantzoulis-Fegaras et al., 1999; Laumonnier et al.,

2000; Tang et al., 1995; Grumbach et al., 2005). Deletion experiments revealed

that some binding sites are essential for eNOS promoter activity, in particular Sp1

and GATA (German et al., 2000).

Given the list of transcription factors that bind to the eNOS promoter it is

20

1.5 Nitric oxide

hardly surprising that eNOS mRNA levels in cultured and native endothelial cells

can be modulated by numerous stimuli (Searles, 2006). Although the term in-

ducible has been restricted to iNOS (NOS 2), eNOS is also regulated by a vari-

ety of stimuli (Bruch-Gerharz et al., 1998; Govers & Rabelink, 2001). For in-

stance, TNF-α is known to lower eNOS expression by decreasing the half-life of

its mRNA (Lai et al., 2003). In addition, TNF-α induced destabilization of eNOS

message has been observed by others. Yoshizumi et al. (Yoshizumi et al., 1993)

demonstrated that there was a dramatic decrease in steady-state levels of eNOS

mRNA and protein in human umbilical vein endothelial cells (HUVECs) treated

with the cytokine TNF-α. This finding was consistent with earlier work showing

impaired endothelium dependent vasorelaxation in isolated arteries treated with

TNF-α (Aoki et al., 1989). In nuclear run-on analysis of cells treated with TNF-α,

there was no difference in the rate of eNOS transcription compared with untreated

cells . However, TNF-α treatment resulted in a reduction of eNOS mRNA half-

life from 48 h at baseline to 3 h (Yoshizumi et al., 1993).

Co-translational modification and post-translational regulation of eNOS

It was also demonstrated that there is a marked discrepancy among the amounts

of eNOS mRNA, protein expression and activity, strongly suggesting a regulatory

mechanisms at post-transcriptional (Yoshizumi et al., 1993; Forstermann et al.,

1998) and post-translational level (Govers & Rabelink, 2001).

In contrast to the other NOS isoforms, eNOS contains a myristoyl group that is

covalently attached to the glycine residue at its NH2 terminus. The turnover of the

myristoyl group is as slow as that of eNOS itself, demonstrating the irreversibil-

ity of myristoylation (Liu et al., 1995). Myristoylation renders eNOS membrane

bound, whereas iNOS and nNOS are predominantly, if not exclusively, cytoplas-

mic. Indeed, the myristoyl moiety is and absolute requirement for the membrane

localization and activity of eNOS (Sakoda et al., 1995).

The monomers that compose the active eNOS dimer are also palmitoylated

21

Introduction

(Sessa et al., 1995). This post-translational modification does not modify eNOS

activity, is reversible, requires myristoylation and stabilizes the association with

intracellular membranes. The membrane association is required for the phospho-

rylation and activation of eNOS (Patterson, 2002). Functional eNOS can be de-

tected in at least three membrane compartments: the Golgi apparatus (O’Brien

et al., 1995; Sessa et al., 1995), the plasma membrane (Hecker et al., 1994) and

the plasmalemmal caveolae, a specialized plasma membrane domain principally

composed by caveolins proteins (Feron et al., 1996; Garca-Cardea et al., 1996;

Liu et al., 1996; Govers et al., 2002).

The co-localization of the signal transduction molecules and proteins that

comprise the eNOS signaling complex within the different membrane compart-

ments facilitates enzyme activation, NO production, and the activation of down-

stream effector pathways (Govers & Rabelink, 2001).

Another determinant of eNOS expression is NO itself. NO has been shown

to be involved in a negative-feedback regulatory mechanism and decreases eNOS

expression via a cGMP-mediated process (Vaziri & Wang, 1999). In agreement,

the decrease in glomerular filtration rate after administration of LPS could be at-

tributable to inhibition of eNOS function, most likely by NO auto-inhibition via

activation of iNOS (Schwartz et al., 1997).

1.5.3 Inducible Nitric Oxide Synthase (iNOS)

In contrast to eNOS and nNOS, iNOS, once expressed, is present in much greater

amounts and is continuously active due to the tight binding of calmodulin even at

basal levels of cytosolic Ca2+. These properties result in the production of much

greater amounts of NO by iNOS, typically within the micromolar range, as com-

pared with eNOS and nNOS (Cho et al., 1992; Stuehr et al., 2001).

Thus, the relatively large amounts of NO and its reaction products produced

by iNOS are capable of killing bacteria, viruses, and other infectious organisms

22

1.5 Nitric oxide

and are also capable of causing tissue damage (Hobbs et al., 1999). Indeed, NO is

extremely reactive and short-lived. A variety of reactive products of NO formed

in tissues, including peroxynitrite, NOX , and N2O3, are likely the molecules re-

sponsible for tissue damage (Bruch-Gerharz et al., 1998; Stuehr et al., 2001).

Regulation of iNOS

The iNOS gene is quiescent in most tissues until it is transcriptionally activated

by diverse stimuli to produce large amounts of NO (Kone & Baylis, 1997). Ac-

cordingly, both positive and negative modulators have evolved to control tightly

iNOS expression and to prevent untoward effects of excessive NO production.

The 5’ flanking region of iNOS gene was cloned and sequenced for mouse

(Xie & Nathan, 1993; Lowenstein et al., 1993), rat (Zhang et al., 1998) and hu-

man (Nunokawa et al., 1994). The large size of these region suggested a complex

regulation of induction. iNOS transcription is regulated in a complex manner by

several constitutive and inducible transcription factors, including CREB (Eber-

hardt et al., 1998), C/EBPbeta (Eberhardt et al., 1998), NF-κB (Beck & Sterzel,

1996; Neufeld & Liu, 2003) and many others cytokines responsive elements such

as: AP-1, γ-IRE, NF-IL6, GAS, IRF-E, ISRE, TNF-RE, and X box (Chu et al.,

1998). Indeed, the promoter region of human iNOS contains multiple binding

sites for NF-κB (Taylor et al., 1998; Xie & Nathan, 1994). Various stimuli in a

wide variety of cells induce iNOS (Taylor & Geller, 2000; Rao, 2000; Frstermann

& Kleinert, 1995). It was demonstrated that iNOS can be regulated by stimuli

including cytokines, e.g., IFN-γ, IL-1β, and TNF-α that, have been shown to ac-

tivate NF-κB (Chu et al., 1998; Neufeld & Liu, 2003). In contrast, transforming

growth factor-β (Pfeilschifter & Vosbeck, 1991), interleukin (IL)-13 (Saura et al.,

1996), and STAT3 (Yu et al., 2002b) suppress iNOS transcription.

Epigenetic controls on iNOS transcription are also operative, and it was shown

that hyperacetylation (Yu et al., 2002b) and DNA methylation (Yu et al., 2002a)

limit iNOS activation. Although much is known about the cis and trans regula-

23

Introduction

tory factors controlling activation of iNOS transcription by cytokines and bacterial

LPS, relatively little is known about how iNOS transcription might be constrained

and how local changes in chromatin structure might participate in this process.

On the other hand, iNOS is also regulated post-transcriptionally. Different and

multiple levels may affected iNOS activity (Nathan & Xie, 1994). Among them:

• mRNA and protein stability (Vodovotz et al., 1993);

• binding of calmoduling (Cho et al., 1992);

• activity of kinase and phosphatase regulating the protein phosphorylation

(Dawson et al., 1993; Michel et al., 1993);

• availability of subtracts and cofactors (Vodovotz et al., 1994; Albina et al.,

1988; Gross & Levi, 1992);

• NO itself (Assreuy et al., 1993; Griscavage et al., 1993);

• subcellular localization (Vodovotz et al., 1993).

Complex regulation of iNOS at multiple levels may reflect the dual role of

iNOS in host defense and autotoxicity (Bogdan, 2001a).

1.5.4 Nitric oxide and pathophysiology

Excessive NO production has been associated to several pathologies. The con-

centration of NO produced within a cell has also significant implications for the

ultimate signals produced. Under certain pathological conditions such as inflam-

mation, up-regulation of inducible NOS affords production of NO at low micro-

molar concentrations (Xie & Nathan, 1994). In this concentration range, NO

competes effectively with the enzyme superoxide dismutase (SOD) for O–2 , facili-

tating formation of ONOO− and other reactive nitrogen species (RNS) (Koppenol

et al., 1992). This increase in tissue RNS, a condition termed “nitrosative stress”

(Hausladen et al., 1996), leads to the modification of cellular targets such as thi-

ols, proteins, and lipids, many of which have implications for cellular signaling

24

1.5 Nitric oxide

(Davis et al., 2001).

Excessive NO production was linked to pathologies including: immune-type

diabetes, inflammatory bowel disease, rheumatoid arthritis, carcinogenesis, septic

shock, multiple sclerosis, transplant rejection and stroke. On the other hand, sev-

eral pathologies were linked to insufficient NO production, including: hyperten-

sion, impotence, arteriosclerosis and susceptibility to infection (Bogdan, 2001a;

Bruch-Gerharz et al., 1998; Nathan, 1992).

In the immune system, the use of NO donors and NOS inhibitors and the anal-

ysis of NOS knock out mice have provided evidence that NO governs a broad

spectrum of processes (Bogdan, 2001a). These include the differentiation, pro-

liferation and apoptosis of immune cells, the expression adhesion molecules, the

production of cytokines and other soluble mediators, and the synthesis and depo-

sition of extracellular matrix components (Marshall et al., 2000; Bogdan, 2001b;

Pfeilschifter et al., 2001). Many molecular targets for NO have been identified

whose contribution to a specific phenotype.

High-input NO release may strongly affect endothelial cell functions. In-

creased NO production likely plays an important role in different steps of an-

giogenesis, modulating migration, proliferation, and endothelial cell organization

into a network structure (Papapetropoulos et al., 1997; Shizukuda et al., 1999;

Fukumura & Jain, 1998).

NO is a principal factor involved in the anti-atherosclerotic properties of the

endothelium (Endemann & Schiffrin, 2004). It has been documented that NO

plays a critical role in vascular endothelial growth factor-induced angiogenesis

(Hood et al., 1998), vascular hyper-permeability mediated by eNOS and iNOS ex-

pression in vitro (Papapetropoulos et al., 1997) and down-regulation of cytokine-

induced endothelial cell adhesion molecule expression (Jiang et al., 2005). In

agreement with these findings, inhibition of the NO-producing enzyme eNOS

caused accelerated atherosclerosis in experimental models (Davignon & Ganz,

2004).

25

Introduction

NO interferes in vitro with key events in the development of atherosclerosis,

such as monocyte and leukocyte adhesion to the endothelium (Landmesser et al.,

2006). Also, high concentrations of NO have been implicated in the modulation

of leukocyte recruitment by the regulation of adhesion molecule expression on en-

dothelial cells (Zadeh et al., 2000) and in the microbicidal activity of endothelial

cells (Jiang et al., 2005; Bogdan, 2001a). NO also decreases endothelial perme-

ability and reduces vessel tone, thus decreasing flux of lipoproteins into the vessel

wall (Rubbo et al., 2002). Finally, NO has been shown to inhibit vascular smooth

muscle cell proliferation, migration (Endres & Laufs, 1998) and platelet aggre-

gation (Radomski et al., 1987). It has been proposed that eNOS has a dual role

in the pathogenesis of atherosclerosis: under normal conditions, it generates low

concentrations of NO and probably peroxynitrite (Koppenol et al., 1992), which

favor an anti-atherosclerotic environment (Endemann & Schiffrin, 2004; Wever

et al., 1998). However, during hyperlipidemia and atherosclerosis, it may con-

tribute to the formation of oxidative stress by a reduction in BH4-dependent NO

formation and unopposed superoxide formation by the enzyme (Schillinger et al.,

2002). Particularly, in the setting of local induction, iNOS could favor the devel-

opment of local toxic concentrations of peroxynitrite in atherosclerotic plaques

(Lee et al., 2004). This concept further emphasizes the role of redox state as a

determinant of vascular integrity in atherosclerosis (Stocker & Keaney, 2004; En-

demann & Schiffrin, 2004; Davignon & Ganz, 2004).

In summary, NO production plays a role in the physiology or pathophysiology

of almost every organ system. Thus, it should come as little additional surprise

to learn that the production of NO is regulated by means as diverse and complex

as NOS functions. The diversity of ways in which NO production can be timed,

confined, augmented, or suppressed, combined with the wide spectrum of NO’s

molecular targets, helps explain how one molecule can serve many functions.

26

1.6 Adhesion molecules


Most eukaryotic cells have the ability to recognise and react functionally to ex-

tracellular matrices. This is true not only for actively migrating cells that use

adhesive contact for traction and guidance, but also for stationary cells that re-

quire a platform for support and orientation.

Cells in vivo must form contacts with their neighbours or with the extracellu-

lar matrix (ECM) in order to form tissues or organs. The macromolecular compo-

nents of ECM, which are secreted by resident cells, include proteglycans, glyco-

proteins and collagens that are secreted and assembled locally into an organised

network to which cells adhere (Hay, 1981). Other members of the ECM, includ-

ing adhesive molecules such as laminin, vitronectin and fibronectin, facilitate the

adherence of cells to their substratum (Hay, 1981; Humphries, 1990).

ECM not only fills intercellular spaces, shaping and strengthening many tis-

sues. The ECM offers structural support for cells, and can also act as a physical

barrier or selective filter to soluble molecules. On the other hand, ECM can in-

fluences cellular functions such as state of differentiation and proliferation (Wylie

et al., 1979; Adams & Watt, 1993; Springer, 1990). ECM components regulate

differentiation and development by mechanisms involved intracellular events that

may transduce signals between ECM receptors and the nucleus (Adams & Watt,

1993; Aplin et al., 2002).

Cell adhesion receptors identified to date mediate both homophilic adhesion,

which involves binding of an adhesion molecule on one cell to the same adhe-

sion molecule on a second cell and heterophilic adhesion, in which an adhesion

molecule on one cell type binds to a different type of cell adhesion molecule on a

second cell. The T-cell interaction with antigen-presenting target cells in the im-

mune system is the best known example of heterophilic adhesion (Springer, 1990).

Diversity in the composition of ECM in different tissues and at different stages of

development arises not only through expression of different matrix molecules, but

also from the existence of multiple forms of individual molecules.

27

Introduction

Many different molecules have been identified by using specific monoclonal

antibodies and the subsequent identification of genes responsible for encoding

these molecules has shown that they are structurally different from each other

(Wylie et al., 1979).

The cell adhesion molecules can be divided into 4 major families: A) the

cadherin superfamily (Takeichi, 1988), B) the selectins (Bevilacqua & Nelson,

1993), C) the immunoglobulin superfamily (Hogg et al., 1991) and D) the in-

tegrins (Hynes, 1987) (Figure 1.7). The interactions of the adhesion molecules

with the ECM has a homeostatic function in promoting tissue regeneration during

wound healing (Eliceiri, 2001), while aberrant adhesion contributes to the etiol-

ogy and pathogenesis of a number of major human diseases including asthma,

allergy, cardiovascular disease and cancer (Kelly et al., 2007; Blankenberg et al.,

2003; Juntavee et al., 2005).

Adhesion molecules mediate many other different functions, acting as recep-

tors for growth factors and mediating cell-cell adhesion rather than cell extra-

cellular matrix interactions (Lster & Horstkorte, 2000). Adhesion molecules are

important on early phase of atherosclerosis involving the recruitment of inflam-

matory cells from the circulation and their transendothelial migration (Kelly et al.,

2007; Jang et al., 1994; Petri & Bixel, 2006).

The two major subsets of adhesion molecules participating in the inflamma-

tory disease are: the selectins, in particular E and P selectins and the immunoglob-

ulin gene superfamily, in particular vascular cell adhesion molecule 1 (VCAM-1)

and intercellular adhesion molecule 1 (ICAM-1) (Blankenberg et al., 2003; Jang

et al., 1994). Selectins, belong to a family of Ca+2 dependent carbohydrate binding

proteins, mediate the earlier adhesion of leukocytes to the endothelium during the

rolling step of leukocyte extravasations in inflammation. VCAM-1 is a glycopro-

tein expressed on the surface of activated endothelium and on a variety of cell

types. ICAM-1 is a counter receptor for the leukocyte β2 integrin, LFA-1. ICAM-

1 is expressed on leukocytes, fibroblast, epithelial cells and endothelial cells. The

28


Figure 1.7: Steps in the inflammatory process. The five distinct steps leading to leukocyteaccumulation and tissue damage during inflammatory processes. Selectins, VCAM and ICAMinteraction with leukocyte integrins. From (Jackson, 2002).

expression of this adhesion molecules is also regulated by several cytokines, such

as IL-1β, IL-4, TNF-α and IFN-γ (Dustin et al., 1986; Shimizu et al., 1992a).

1.6.1 The Selectins

The selectins, a family of Ca+2 dependent carbohydrate binding proteins, mediate

the initial attachment of leukocytes to the endothelium on the blood vessel wall

during the rolling step of leukocyte extravasation in inflammation (Abbassi et al.,

1993; Petri & Bixel, 2006).

Selectins recognise fucosylated carbohydrate ligands, especially structures con-

taining Sialyl-LewisX (sLeX ) and Sialyl-Lewisa (sLea), which are heavily ex-

29

Introduction

pressed on neutrophils and monocytes and also found on natural killer cells. These

selectin/carbohydrate interactions permit leukocytes to roll along the vascular en-

dothelium in the direction of blood flow as a prelude to integrin-mediated adhesion

(Munro et al., 1992).

All selectins have a unique and characteristic extracellular region composed of

an amino-terminal calcium dependent lectin-like binding domain which is formed

by a 120-amino acid. This region determines the ability of each selectin to bind

to specific carbohydrate ligands (Drickamer, 1988). This domain is followed by a

sequence of 35-40 amino acids similar to a repeat structure, which was first found

in epidermal growth factor (EGF). The lectin and EGF-like domains are shown

to have 60% to 70% homology at the nucleotide and protein level. There is also

a region composed by two to nine short consensus repeat sequences (SCR), sim-

ilar to those found in complement regulatory proteins. The size variation of the

selectins is due to the different numbers of SCR domains, each ∼60 amino acids

long. This is followed by a single transmembrane region and a short cytoplasmic

tail (Vestweber & Blanks, 1999) (Figure 1.8).

The selectins family consists of three closely related cell-surface molecules:

L-selectin (MEL-14, LAM-1, CD62L), E-selectin (ELAM-1, CD62E), and P-

selectin (PADGEM, GMP-140, CD62P). P-, L-, E-selectin are most closely re-

lated in amino acid sequence within lectin and EGF like domains. Moreover,

these domains mediate specific interactions with similar, if not identical, carbohy-

drate determinants displayed on diverse ligands (Tedder et al., 1995).

All selectins participate in different, though overlapping, ways to the early

steps of leukocyte recruitment at the endothelial surface under shear forces: leuko-

cyte rolling and tethering. By interactions with their ligands, selectins create weak

bonds between activated endothelial cells (E- and P-selectin) and leukocytes (L-

selectin). P-selectin/PSGL-1 binding triggers leukocyte activation, integrin mo-

bilization and induces inflammation and thrombosis (Blankenberg et al., 2003;

Vestweber & Blanks, 1999).

30


Figure 1.8: Structural organization of selectins. Selectins are composed of an amino-terminallectin domain, a single epidermal growth factor (EGF)-type repeat and various numbers of con-sensus repeats or so called complement binding domains, which share sequence homology witha domain structure often found in proteins with complement binding activity. Proteins have asingle transmembrane region and a short cytoplasmic tail. E-selectins have different numbers ofcomplement binding domains in different species.

31

Introduction

Unlike E- and P-selectins, L-selectin is found only on leukocytes and is ex-

pressed continuously throughout myeloid differentiation and on early erythroid

progenitor cells but not on mature erythrocytes (Tedder et al., 1995). L-selectin

was originally reported to mediate lymphocyte binding to high endothelial venules

of peripheral lymph nodes during lymphocyte homing. Subsequently, it was

shown to be expressed on most of other peripheral blood leukocytes and is thought

to be involved in regulating leukocyte traffic in the systemic microcirculation

(Warnock et al., 1998).

P-selectin is another type of selectin adhesion protein that was initially found

in platelets and also is constitutively expressed in endothelial cells (Johnston et al.,

1989). In both cell types, P-selectin is synthesised and stored in cytoplasmic

granules. In platelets P-selectin is contained in the α-granules (Wagner, 2005),

whereas in endothelial cells it is found in Wiebel-Palade bodies (McEver et al.,

1989). P-selectin is mobilized rapidly to the external plasma membrane of en-

dothelial cells and platelets in response to activation with cytokines such as throm-

bin (Tedder et al., 1995). Expression of P-selectin on the cell surface generally

is short-lived. This supports the idea that P-selectin mediates early leukocyte-

endothelial interactions and also mediates the binding of activated B-cells and a

subset of T-cells, to stimulated endothelium in vitro (Wagner, 2005). Since P-

selectin an E-selectin can bind to the tetrasaccharide sLeX and both mediate the

binding of PMNs and monocytes, the function of the endothelial selectins appears

to be redundant (Larsen et al., 1992). The rapid transport of P-selectin to the cell

surface (McEver et al., 1989) and the more slowly acting up regulation by de novo

synthesis of E-selectin (Bevilacqua et al., 1987) had served as an explanation for

this redundancy, arguing for similar functions of both selectins at different time

points. At the same time, the parallel expression of both selectins after induction

with TNF-α might argue for redundancy. However, indirect evidence has emerged

recently, suggesting that the physiological ligands for both endothelial selectins on

the same leukocytes might be different (Hahne et al., 1993; Larsen et al., 1992).

E (endothelial)-selectin is specific from endothelial cells. This adhesion mol-

ecule is almost absent from non activated endothelial cells and become induced

32


upon the exposure of the endothelium to various pro-inflammatory stimuli. E-

selectin synthesis is increased rapidly after cell stimulation by cytokines such as

TNF-α or IL-1β (Invernici et al., 2005) and lipopolisaccharide (LPS). Induction

occurred on the transcriptional level, and within 34 h after stimulation, maximal

levels of E-selectin protein are expressed at the cell surface. Basal levels are

reached again after 16-24 h, in contrast to other cytokine-inducible adhesion mol-

ecules such as ICAM-1 and VCAM-1. A similar mechanism and similar kinetics

of the regulation of mouse E-selectin were found on mouse endothelioma cells

(Hahne et al., 1993).

The 5’-flanking regions of human E-selectin were cloned and sequenced, and

the regulatory elements of the gene were studied intensively. Four regulatory el-

ements were found in the human E-selectin promoter, three of them are NF-κB

binding sites and one is an activating transcription factor (ATF)-binding element

(Kaszubska et al., 1993). NF-κB elements are not sufficient, but necessary, for the

cytokine-stimulated induction of E-selectin transcription (Whelan et al., 1991).

Furthermore, proteosome inhibitors block the degradation of IκB, consequently

block NF-κB activation and inhibit transcriptional activation of E-selectin (Read

et al., 1997). In addition to the NF-κB elements, the ATF element is involved

in cytokine-stimulated expression of E-selectin as well. These two pathways are

rapidly activated and converge on the E-selectin promoter to result in full cytokine

responsiveness of this gene (Read et al., 1997).

1.6.2 Immunoglobulin superfamily adhesion molecules

The immunoglobulin superfamily is the most abundant family of cell surface ad-

hesion molecules, accounting for 50% of leukocyte surface glycoprotein. The

structure of this family is characterized by repeated domains, similar to those

found in immunoglobulins. These 70-100 aminoacid domains are composed of

two β sheets and give rise to immunoglobulin folds that participate to adhesion

sites (Blankenberg et al., 2003; Petri & Bixel, 2006).

33

Introduction

Alternative splicing is frequent in the genes of this family and allows the

production of multiple isoforms. By mutation and deletion analysis these im-

munoglobulin domains have been shown to mediate many different functions, in-

cluding acting as receptors for growth factors and mediating cell-cell adhesion

rather than cell- extracellular matrix interactions (Holness & Simmons, 1994;

Shimizu et al., 1992b). Though not all immunoglobulin-superfamily adhesion

molecules mediate cell-cell interactions. Many glycoprotein which belong to

this family do function as adhesion receptors, including: intercellular adhesion

molecule-1 (ICAM-1; CD54), intercellular adhesion molecule-2 (ICAM-2), vas-

cular cell adhesion molecule-1 (VCAM-1; CD106), platelet-endothelial cell ad-

hesion molecule-1 (PECAM-1; CD31) and the mucosal addressin cell adhesion

molecule-1 (MAdCAM-1). ICAM-1, ICAM-2 and VCAM-1 are involved in the

adhesion of T-cells to endothelial cells by serving as surface ligands for the in-

tegrins LFA-1 (leukocyte-function antigen-1), αLβ2 and α4 β1 (Shimizu et al.,

1992b).

Intercellular Adhesion Molecule-1 (ICAM-1)

The adhesion molecules ICAM-1 (CD54) and ICAM-2 (CD102) are counter-

receptors for the leukocyte β2 integrin, LFA-1 (CD11α/CD18) (Diamond et al.,

1991; van de Stolpe & van der Saag, 1996). ICAM-1 molecule mediate adhe-

sion of leukocytes to activated endothelium by establishing strong bonds with

integrins and inducing firm arrest of inflammatory cells at the vascular surface,

and participate to leukocyte extravasation (Petri & Bixel, 2006; Katagiri et al.,

1996). Linkage with the cytoskeleton, ICAM-1 may localize within regions of the

endothelial cell membrane in order to facilitate leukocyte adherence and transmi-

gration (van der Wal et al., 1994). Conversely, blocking ICAM-1 function with

antibodies prevents leukocytes to firmly adhere to the endothelium, resulting in a

significant reduction in leukocyte trans-endothelial migration in various animals’

models. In line with these experimental findings, ICAM-1 knock-out mice show

an impaired inflammatory response exemplified by reduce tissue infiltration of

neutrophils (Sligh et al., 1993).

34


Figure 1.9: Structure of ICAM-1 domains. Intercellular adhesion molecule-1 (ICAM-1) hasfive immunoglobulin like domains followed by a transmembrane region and a short cytoplasmictail.

ICAM molecules are able to bind more than one ligand by using different

binding domains. The dimerisation or formation of larger protein multimers is

commonly observed for such molecules and may increase binding affinities with

ligands. Amino acid substitutions in the extracellular domains have indicated that

the primary binding site for LFA-1 is located in the NH2-terminal first domain of

ICAM-1 (Stanley & Hogg, 1998; Staunton et al., 1990). A second ligand-binding

site for another β2 integrin on leukocytes (CD11b/CD18, Mac-1) is localized to

the third immunoglobulin-like domain. However, it is clear that the NH2-terminal

two domains in both cases do not contribute equally to the binding site (Figure

1.9).

ICAM-2 has only two extracellular immunoglobulin-like domains and the

binding site for Mac-1 is localized to the third immunoglobulin-like domain of

ICAM-1. The second domain has a less critical role (Holness & Simmons, 1994),

it appears that ICAM-2 contribution as an endothelial ligand for this leukocyte

integrin is rather limited (Staunton et al., 1989; Casasnovas et al., 1999).

35

Introduction

ICAM-1 is expressed on leukocytes, fibroblasts, epithelial cells and endothe-

lial cells (Dustin et al., 1986). ICAM-2 also has a similar tissue distribution

(Blankenberg et al., 2003). ICAM-1 displays molecular weight heterogeneity in

different cell types with a mature form of of 97 kDa on fibroblasts, 114 kDa on

the myelomonocyte cell line U937, and 90 kDa on the B lymphoblastoid cell JY.

ICAM-1 biosynthesis involves a 73 kDa intracellular precursor which is converted

to the mature form in 20 to 30 min. The maturation, in the Golgi complex, is fol-

lowed by transport to the cell surface within a few minutes (Dustin et al., 1986).

In vitro, ICAM-1 expression can be up regulated in responses to proinflam-

matory cytokines such as IFN-γ, TNF-α and IL-1β (Invernici et al., 2005; Sawa

et al., 2007). The induction is dependent on protein and mRNA synthesis and is

reversible. The up-regulation of ICAM- 1 by IL-1β involved a rapid mRNA and

protein synthesis-dependent, which is apparent within 1 hr (Dustin et al., 1986).

On the contrary, ICAM-2 apparently is expressed constitutively and is not regu-

lated by cytokines (van Buul et al., 2007).

It is therefore interesting the characterization to the genomic structure of the

5’-flanking region for the human ICAM-1 gene. It was identified to be a func-

tional potent promoter region. Structural analysis revealed that contained potential

interferon responsive elements, glucocorticoid receptor-binding sites, an NF-κB

consensus element, and AP1 and AP2 sites, regions which may be involved in the

regulation of this gene expression (Voraberger et al., 1991; Muller et al., 1995; De-

gitz et al., 1991). The exact biologic roles played by these potential elements, as

well as other regions involved in the constitutive and tissue-specific regulation of

ICAM-1 gene expression, are currently under investigation (Degitz et al., 1991).

Vascular Cell Adhesion Molecule-1 (VCAM-1)

Another member of the immunoglobulin gene superfamily, VCAM-1, is a 90–110

kDa glycoprotein which supported the adhesion of mononuclear leukocytes (Petri

36


& Bixel, 2006) and certain tumor cells (Osborn et al., 1989; Rice & Bevilacqua,

1989; Rice et al., 1990). In vitro studies demonstrated that VCAM-1 is expressed

on the surface of isolated human fetal endothelial cells deriving from different or-

gans such as: brain, heart, lung, liver and kidney. In this way, it was supported the

notion that VCAM-1 expression can be up-regulated by interferon-γ (IFN-β) and

several cytokines, such as IL-4, IL-1β and TNF-α (Li et al., 1993; Invernici et al.,

2005; Sawa et al., 2007).

VCAM-1 interacts with the leukocyte integrin α4β1 on many different cells

including eosinophils, monocytes and with α4β7 on activated peripheral T-cells.

Thus α4β1/VCAM-1 interactions, like LFA-1/ICAM-1 interactions, may regulate

the movement of lymphocytes out of blood vessels to cross the endothelium in the

inflammatory sites (Petri & Bixel, 2006). Furthermore, α4β1/VCAM-1 interac-

tion has been shown to be crucial for the binding of hematopoietic precursor cells

to a bone marrow derived adherent cell population (Ryan et al., 1991).

Osborn et al. (Osborn et al., 1989) demonstrated on HUVEC cells treated

with IL-1, that VCAM-1 contains six immunoglobulin domains . On the other

hand, Cybusky et al. (Cybulsky et al., 1991), reported that VCAM-1 contained

an additional 276 base-pair domain, located between domains 3 and 4. Together,

these data indicate that the two forms of mRNA arise by alternative splicing, al-

though the seven-domain form appeared predominant. On the surface of HUVEC

cells only a 110 kDa polypeptide was detectable by immunoprecipitation. This is

consistent with the seven-immunoglobulin like domain form of VCAM-1 (Cybul-

sky et al., 1991). Alternative splicing of the VCAM-1 gene, in cytokine activated

endothelium, may generate functionally distinct cell-surface adhesion molecules

(Figure 1.10). In this way, it was demonstrated by functional analysis that the

major form of VCAM-1 has seven extracellular immunoglobulin like domains

(VCAM-7D). Moreover, the three NH2-terminal domains (domains 1-3) are sim-

ilar in amino acid sequence to domains 4-6. However, on the minor form of

VCAM-1 (VCAM-6D), the domain 4 is deleted by an alternative splicing (Os-

born et al., 1992).

37

Introduction

Figure 1.10: Structure of VCAM-1 different isoforms domains. Vascular adhesion molecule-1 (VCAM-1) has either six or seven immunoglobulin domains followed by a transmembrane re-gion and a short cytoplasmic tail.

It was determined that either the first of the homologous fourth domain of

VCAM-1 are required for VLA-4-dependent adhesion (Jackson, 2002). These

binding sites can function in the absence of the other. When all are present, cell

binding activity is increased relative to monovalent forms of the molecule. Thus,

VCAM-1 exemplifies evolution of a functionally bivalent cell-cell adhesion mol-

ecule by intergenic duplication (Osborn et al., 1992).

The characterization to the genomic structure of the 5’-flanking sequences

of the human VCAM-1 promoter was also performed. It was identified a func-

tional potent promoter cis-acting sequences that direct the cytokine-induced tran-

scription. Within the cytokine-responsive region of the core promoter were func-

tional NF-κB and GATA elements. Upstream of the core promoter, the VCAM-1

5’flanking sequence contained a negative regulatory activity. NF-κB mediate in

this way activation of VCAM-1 gene expression (Neish et al., 1992).

Cell adhesion and adhesion molecules have been shown to contribute to the

pathogenesis of a large number of common human disorders and tumor cell metas-

tasis in cancer. Several studies have demonstrated that cell adhesion molecules are

38

1.7 Signal transduction pathways

involved in signal transduction pathways (Adams & Watt, 1993). These molecules

transmit signals from the extracellular matrix on the cell interior (outside-in) and

from the inside of the cell to the outside of the cell (inside-out) similar to those

transduced by growth factors, hormones and cytokines. These results might be

extremely significant in metastatic spread and the treatment of a large number of

human disorders.


It has become clear over the last few years that, in addition to enabling leukocytes

to adhere to endothelium, adhesion molecules are also involved in intracellular

signal transduction. Leukocyte responses to integrin engagement have been exten-

sively studied, while responses of endothelial cells have received much less atten-

tion. Nevertheless, leukocyte adhesion is known to be associated with alterations

in the functional state of endothelium, affecting surface protein expression, se-

cretory function, permeability to macromolecules, and leukocyte transmigration.

These responses are associated with intracellular signals, including cytoskeletal

modification, protein phosphorylation, and calcium influx.

Transcriptional regulation, a critical basal mechanism in fundamental biologic

processes, requires the participation of several classes of proteins: those that binds

specific DNA sequences, those associate with transcriptional regulators through

protein-protein interactions (coactivators or corepressors) and those that perform

an architectural function. Collectively, these proteins interact with the compo-

nents of the basal transcription apparatus to affect gene transcription. In addition,

it has been widely shown that most cytokines action involves the activation of

transcription factors (e.g. NF-κB, AP-1) and protein kinases (e.g. PKA and PKC)

that in turn, regulate the expression of many target genes, indispensable to the

maintenance of the inflammatory state and are involved in the pathophysiology of

inflammatory diseases (Kleinert et al., 1998; Hanada & Yoshimura, 2002).

39

Introduction

1.7.1 cAMP-response element(CRE)-binding protein (CREB)

Another important transcription factor is the cAMP-response element (CRE) bind-

ing protein (CREB). CREB is a 43 kDa nuclear transcription factor member of a

family of cAMP-responsive activators. In mammalian systems this family in-

cludes also the activating transcription factor 1 (ATF1) and the cAMP response

element modulator (CREM)(Mayr & Montminy, 2001).

As indicates by its name, CREB is activated by phosphorylation in response

to, among other signals, cAMP. The accumulation of cAMP in response to acti-

vation of guanine-nucleotide-binding (G)-protein-coupled receptors induces most

cellular responses through the cAMP-dependent protein kinase (PKA).

The primary structure of the CREB family reveals a centrally located 60 amino

acid kinase inducible domain (KID). This domain contains the a PKA phosphory-

lation site (RRPSY) as well as several potential phosphorylation sites for casein

kinase I and II (Brindle et al., 1993; de Groot et al., 1993). There is also a basic

region of leucine zipper (bZIP) dimerization domain located at the carboxy termi-

nally site in all members of the family.

Phosphorylation of the serine residue at 133 (Ser 133), promotes recruitment

of the transcriptional co-activator CBP and its paralogue p300 (Kwok et al., 1994;

Arias et al., 1994). It was demonstrated that Ser 133 phosphorylation is response

to cAMP stimulation is sufficient to induce target gene expression through pro-

moters containing only CRE site. At the same time additional promoter bound

factors seems to be required for gene activation by CREB in response to mitogen

and stress signals. This cooperative interaction permits the efficient recruitment

of CBP (Mayr et al., 2001).

At the basal state, PKA resides in the cytoplasm as an inactive heterotetramer

of paired regulatory (R) and catalytic (C) subunits. Induction of cAMP liberates

the C subunits, which passively diffuse into the nucleus and induce cellular gene

expression by phosphorylating CREB at serine residue 133 (Figure 1.11).

40


The mechanism by which the cAMP-signaling pathway can achieves speci-

ficity include:

• compartmentalization of PKA via binding to scaffolding proteins;

• regulated expression of the distinct regulatory and catalytic subunit accord-

ing cell and tissue;

• differential combinations of the regulatory and catalytic subunit isoforms.

It has been reported that specific localization and association of PKA type I is

activated on the cytoplasm and by a downstream pathway activated CREB phos-

phorylation that induced gene transcription (Constantinescu et al., 2002).

Furthermore, it has been demonstrated this transcription factor is necessary

for the activation and induction of several targets genes. Among them, VCAM-1

(Ono et al., 2006), E-selectin were reported to be regulated by this transcription

factor on endothelial cells (Gerritsen et al., 1997).

Recent results in HUVEC cells demonstrated that after TNF-α stimulation the

E-selectin gene activation is dependent of CBP and the closely related factor p300

that can interact with p65. The induction is dependent of chromatin remodeling by

selective histone modification involving hyper-acetylation, phosphorylation and

methylation (Edelstein et al., 2005).

1.7.2 NF-κB

NF-κB is an important transcription factor that plays a central and evolutionary

conserved role in many cellular responses to environmental changes. Several

pro-inflammatory genes involved in controlling, for example, cell adhesion, im-

mune stimulation, apoptosis, chemoattraction, differentiation, extracellular matrix

degradation, redox metabolism, and production of mediators have been shown to

41

Introduction

Figure 1.11: Activation of the cAMP-CREB signalling pathway. Induction of adenylyl cy-clase (AC) by ligand (L)-bound receptor (R) proceeds through activation of the heterotrimeric Gprotein (G). Increases in the levels of cellular cAMP promote dissociation of the protein kinase A(PKA) heterotetramer, which consists of paired regulatory (R) and catalytic (C) subunits. Liber-ated C subunits migrate into the nuclear compartment by passive diffusion and phosphorylate thecyclic AMP response element (CRE)-binding protein (CREB) at a single phospho-acceptor site,Ser133. The phosphorylation promotes transcription by recruitment of the co-activator CREB-binding protein (CBP). CBP mediates transcriptional activation through its association with RNApolymerase II (Pol II) complexes and through intrinsic histone acetyltransferase activity. Targetgene activation is terminated by the serine/threonine phosphatase PP-1-mediated dephosphoryla-tion of CREB. From (Mayr et al., 2001)

42


be regulated by NF-κB (Kempe et al., 2005).

NF-κB exists in the cytoplasm of the majority of cell types as homo (Fujita

et al., 1992) or heterodimers (Inoue et al., 1991; Urban et al., 1991) of a family

of structurally related proteins. Five proteins belonging to the NF-κB family have

been identified in mammalian cells: p65 (RelA), c-Rel, RelB, p50/p105 (NF-κB1)

and p52/p100 (NF-κB2). The first three are produced as transcriptionally active

proteins; the latter are synthesized as longer precursor molecules of 105 and 100

kDa respectively, which are further process to the smaller, transcriptional active

forms by processed that are not fully understood (Ghosh et al., 1998).

Each member of this family contains a conserved N-terminal region called

the Rel-homology domain (RHD) and the nuclear localization signal (NLS). The

RHD domain is responsible for DNA binding (Schreck et al., 1990), dimerization

and association with the inhibitory proteins (Verma et al., 1995)(Figure 1.12).

NF-κB dimers are sequestered in the cytosol of unstimulated cells via non-

covalent interactions with a class of inhibitory proteins called IκB. These proteins

also comprise a structurally and functionally related family of molecules (Verma

et al., 1995).

Seven IκB molecules have been identified: IκBα, IκBβ, IκBγ, IκBε, Bcl-3,

p100 and p105 (Baeuerle, 1998b; Link et al., 1992). All known IκB proteins con-

tain multiple copies of a 30–33 amino acid sequence called ankyrin repeats; and

the specific interaction between the ankyrin repeats and the RHD is the defining

feature of the association between NF-κB and IκB. Through these associations,

IκB molecules mask the NLS of NF-κB. Thus, IκB degradation would simply

lead to unmasking of the NLS, allowing free NF-κB dimers enter the classical

nuclear import pathway (Verma et al., 1995).

The nuclear translocation of this protein complex may be due to cellular stim-

ulation with inflammatory cytokines, phorbol esters, UV radiation. The phospho-

rilation, ubiquitination, and proteosomal degradation of IκB causes the nuclear

43

Introduction

Figure 1.12: Schematic Presentation of NF-κB and IκB Structure. The numbers refer to theankyrin repeats. Right circles represent p50 and left circles p65 with their two Ig-like domains.Dashed lines indicate sequences missing from the structures. RHD, rel homology domain; P,phosphate groups on serines 32 and 36; C and N, C and N termini of the three proteins. Shown 1to 6 IκBα domains. From (Baeuerle, 1998b)

44


translocation and is involved into the inflammatory response by induction of dif-

ferent genes (Ghosh & Karin, 2002).

TNF-α and IL-β act as a primary endogenous inducers of NF-κB. When cells

are exposed to those pro-inflammatory cytokines, a cascade of events leads to the

phosphorylation and subsequent degradation of IκB. As the result, NF-κB is lib-

erated and can enter to the nucleus for gene expression activation. The stimulation

and activation of NF-κB do not require protein synthesis, there is a rapid and effi-

cient induction of target genes (May & Ghosh, 1998).

Activation of NF-κB through IκB phosphorylation and degradation depends

on IκB kinases (IKKs) activity (May & Ghosh, 1998). The IKK complex is com-

posed of three subunits, the catalytic subunits IKKα (IKK1) and IKKβ (IKK2)

and the regulatory subunit IKKγ (IKKAP or NEMO, NF-κB essential modulator),

and was originally identified as a high-molecular-weight kinase complex able to

phosphorylate serines 32 and 36 of IκBα (Verma et al., 1995).

There is evidence that IkBα, which is very rapidly resinthesized after degra-

dation, can enter to the nucleus and remove IκBα from DNA. The discovery of

the leucin rich nuclear export sequences (NES) supported this idea (Arenzana-

Seisdedos et al., 1997). The inactive complex is then transported back into the

cytoplasm or degraded in the nucleus thereby completing a cycle of activation and

inactivation of NF-κB. However, NES sequence was not found in IκBβ (Malek

et al., 2001), protein that was shown to be functional equivalent to IκBα (Cheng

et al., 1998). Futhermore, the mechanism responsible for the nuclear uptake re-

mained controversial. Moreover, the biological significance of this process its yet

to be establish.

On the other hand, it was demonstrated a basal phosphorylation of IκBα in

un-stimulated cells. This basal phosphorylation occurs at the carboxy-terminal

casein kinase II sites. The presence of free IκBα in un-stimulated cells would

prevent rapid induction and reduce the sensitivity of the NF-κB system (Barroga

et al., 1995). It is important to note that IκBα in its un-stimulated state is con-

45

Introduction

tinuously turning over (Rice & Ernst, 1993; Henkel et al., 1993; Miyamoto et al.,

1994). The half-life of IκBα is ∼2.5 hr in the 70Z/3 murine pre-B cell line, mak-

ing it a very unstable protein (Miyamoto et al., 1994). Moreover, the half-life of

Rel/NF-κB is much longer in the same cells (Miyamoto et al., 1994). This is in

agreement with an earlier observation that NF-κB is regulated by a labile inhibitor

(Sen & Baltimore, 1986). Additionally, it explains why inhibition of protein syn-

thesis results in NF-κB activation (Sen & Baltimore, 1986). If IκBα turning over

faster than NF-κB, the lack of IκBα synthesis will eventually lead to the presence

of free NF-κB.

Recently, it was shown that IκBα was able to regulate other pathways such

as p53, a tumor suppressor protein, by preventing the p53 nuclear translocation.

The C terminal of IκBα enhanced cell dead, which suggests that may be a pro-

apoptotic protein. Interestingly, the relationship of NF-κB, p53 and IκBα and the

mechanism remains to be determined (Li et al., 2006).

An aspect of the NF-κB system that has not been extensively studied is the

kinetics of nuclear translocation of NF-κB proteins following activation. Al-

though complete IκBα degradation and maximum DNA-binding activity appears

in <10 min following stimulation in some cells, the amount of NF-κB proteins

that translocate into the nucleus within the same period is <l0%-20% of total NF-

κB proteins (Miyamoto et al., 1994). A possible explanation for this effect is that

some NF-κB proteins may be associated with other IκB proteins, such as IκBβ,

Bcl-3, p105, and p100. Also, the nuclear translocation machinery may reach a

saturation point. Additionally, there may be others unexplored regulatory steps

important for the nuclear translocation.

Anti-inflammatory inhibition of NF-κB

Inhibitors of NF-κB activation are useful tools for elucidating molecular mecha-

nism involved in gene expression. The regulatory role of NF-κB in inflammatory

pathways can be further characterized when several mechanistically distinct in-

46


hibitors are studied in the same model of gene expression.

Several steps of the NF-κB signal transduction pathway can be targeted by

various inhibitors:

• IKK activation;

• IκB phosphorylation and degradation;

• NF-κB nuclear translocation and transcriptional activity.

Several studies demonstrated that different molecules were able to inhibit NF-

κB pathway. This molecules were classified according the structure and activ-

ity include: aspirin, salicylates, nonsteroidal anti-inflammatory drugs, glucocorti-

coids, antioxidants, proteasome inhibitors, antisense oligodeoxynucleotides, nat-

ural compounds and cell penetrating peptides (Delhalle et al., 2004). All of them

were reported to function through distinct mechanisms in vivo and in vitro as are

summarized in Table 1.1.

The generation of reactive oxygen species (ROS) by phagocytic leukocytes

(neutrophils, monocytes, macrophages, and eosinophils) is one of the most im-

portant hallmarks of the inflammatory process. By oxidizing essential cellular

components of invading pathogens, reactive radicals and oxidants also represent

the first line of defense against microorganisms (Hensley et al., 2000). In ad-

dition, to promoting general cytotoxicity, ROS may also act to up-regulate pro-

inflammatory gene expression by activating NF-κB, a process that is itself sensi-

tive to the cellular redox state (Schoonbroodt & Piette, 2000). Diverse agents that

cause oxidative stress can activate NF-κB (Schreck et al., 1991; Zhang & Chen,

2004) and numerous stimuli that activate NF-κB, including cytokines, phorbol es-

ters, LPS, and CD3 engagement, increase the levels of intracellular ROS (Bowie

& O’Neill, 2000a). Although evidence for the role of ROS in pro-inflammatory

NF-κB activation remains circumstantial, more convincing studies demonstrated

that a variety of antioxidant molecules, such as N-acetylcysteine (NAC), dithio-

carbamates, vitamin E derivatives, and glutathione peroxidase, can inhibit NF-κB

47

Introduction

Table 1.1: NF-κB inhibitors that demonstrate anti inflammatory activity in experimentalmodels

Class In vitro In vivo

Salicylatesaspirin, sulfasalazine, triflusal Synovial fibroblast, lung epithelial

cells, dendritic cells, monocytes,macrophages, T-cells, endothelialcells, vascular smooth muscle cells.

Contact hypersensitivity, zymosan-inducedpaw inflammatio

NSAIDsibuprofen, sulindac, tepoxalin Macrophages, endothelial cells, T-

cellsZymosan-induced inflammation in the pawand spinal cord

Glucocorticoidsdexamethasone, hydrocortisone Macrophages, endothelial cells,

pulmonary epithelial cells, T-cellsCarrageenin-induced air pouch, peritonealsepsis, myocardial contractile depression

Anti-sense oligodeoxynucleotidesanti-p50, anti-p65 Fibroblast, B-cells, T-cells Graft rejection, septic shock

Transcription factordecoy-oligodeoxynucleotides Endothelial cells, vascular smooth

muscle cells, macrophagesRheumatoid arthritis, ischemia-reperfusioninjury, nephritis, carrageenin-induced pawinflammation, Arthus reaction

Natural compoundsflavanoids, polyphenols, sesquiter-pene lactones, curcumin, sesterter-pene

T-cells, macrophages, fibrosarcomaand epithelial cells

Septic shock, TPA-induced skininflammation

AntioxidantsPDTC, N-acetylcysteine, VitaminE, Vitamin C

Macrophages, monocytes, T-cells Septic shock, neutrophilic alveolitis, mul-tiple organ injury, experimental allergicencephalomyelitis

Proteasome inhibitorslactacystin, MG132, TLCK, TPCK,PSI, PS-519, PS341

Macrophages, monocytes, T-cells,B-cells

Asthma, septic shock, neutrophilic alve-olitis, cerebral and myocardial ischemia-reperfusion injury

PeptidesSN50, NLS, NBD, TIRAP Macrophages, T-cells, endothelial

cells, vascular smooth cellsSeptic shock, zymosan-induced peritoni-tis, PMA-induced ear edema, carrageenin-induced paw inflammation, Arthus reaction,inflammatory bowel disease

48


activation (Szotowski et al., 2007; Bowie & O’Neill, 2000b).

Indeed, dithiocarbamates are widely used in basic and clinical resarch and

seams to be more potent and effective than others antioxidants as NAC and glu-

tathione (GSH) (Zhu et al., 2002). In agree with different studies, the antioxidant

molecular mechanism of NAC and dithiocarbamates is different. In a study con-

ducted in human pulmonary vascular endothelial cells that had been pre-incubated

with NAC and stimulated with TNF-α. NAC attenuated TNF-α induced activa-

tion of the mitogen-activated protein (MAP) kinase cascades and in these way

intracellular GSH levels were increased (Hashimoto et al., 2001). However NAC

effects as antioxidants on endothelial cells through NF-κB pathway seams to be

controversial an not fully understood (Schubert et al., 2002).

Pyrrolidine dithiocarbamate (PDTC) is a NF-κB inhibitor (Schreck et al., 1992).

It was demonstrated that PDTC treatment prevents IκBα degradation, thereby

blocking NF-κB activation (Tamada et al., 2006). Indeed, PDTC does not lead

to the appearance of a newly phosphorylated IκBα variant, suggesting that the

drug blocked phosphorylation. In addition to IκBα degradation, phosphorylation

is necessary for NF-κB activation but not for the direct release of IκBα. The

modification seems to dramatically enhance the rate of proteolytic breakdown by

proteosome (Traenckner et al., 1994). Additionally, PDTC can inhibits NF-κB

induction by lipopolisaccharide. In this way regulates the expression of endoge-

nous tissue factor, a glycoprotein receptor for coagulation factors VII and VIIa on

HUVEC cells (Orthner et al., 1995). Moreover, PDTC is able to inhibit specifi-

cally the production of IL-6, IL-8 and granulocyte macrophage colony stimulating

facto in response to inflammatory mediators on HUVEC cells (Muoz et al., 1996).

As described previously, E-selectin, ICAM-1 and VCAM-1 expression are

under the control of NF-κB signalling (Hanada & Yoshimura, 2002; Lin et al.,

2007) . The combined treatment of cytokines such as TNF-α and IL-1β induced

the expression of these genes on HUVEC cells. The NF-κB role was confirm by

over-expression of dominant negative inhibitor IκB protein and also by combi-

natory treatment with several inhibitors (PDTC, dexametasone and others)(Kuldo

49

Introduction

et al., 2005). However, NF-κB contribution for VCAM-1 and ICAM-1 expression

is still controversial (Zerfaoui et al., 2008). Others inflammatory markers such as

NO levels and the inducibel nitric oxide synthase are under the control of NF-κB

signalling (Beck & Sterzel, 1996).

Thus, different antioxidants inhibit NF-κB activation via multiple mechanisms,

which may depend on the properties of the antioxidant, its specific target in the

treated cell, or the origin of the treated cells. Development of novel NF-κB in-

hibitory drugs bares an important significance in the prevention and treatment of

cardiovascular diseases. Natural antioxidants originated have a huge advantage

over existing drugs being non-toxic and inexpensive. Their potency as NF-κB

inhibitors on endothelial cells, and the novel mechanism of activation, provide a

strong rational for further studies both in vitro and in vivo.

50

Chapter 2

AIM OF THE STUDY

Several clinical observations pointed out the critical role of bilirubin on the risk

of cardiovascular atherosclerotic disease. It remains unclear whether modestly

elevated or high normal levels of serum bilirubin (as in Gilbert’s syndrome) are

protective or harmful in non-hepatic diseases.

It has been proposed that the antioxidant properties of bilirubin against athero-

matous disease might be exerted at multiple steps preventing: the peroxidation of

lipoproteins in the intima, the oxidation of membrane phospholipids in the en-

dothelial cells and macrophages or even the activation of metalloproteinases in

the intima (Rigato et al., 2005).

Indeed, bilirubin might also act as a second messenger and not merely as a

pharmacological compound. It was shown that bilirubin might have a direct reg-

ulatory effect by binding the aryl hydrocarbon receptor (Seubert et al., 2002) or

indirectly by activation of constitutive androstane receptor (Huang et al., 2004).

Bilirubin, that so far was regarded as a waste product of heme metabolism,

must be consider as an active molecule with many unexplored functions and ther-

apeutic potential.

The aim of this study is to investigate the effect of the unconjugated bilirubin

(UCB) in the endothelial dysfunction, as the earliest event in the development of

the atherosclerotic disease. Specifically, UCB effects on the nitric oxide metab-

51

Aim of the Study

olism, the vascular adhesion molecules expression and the main signaling path-

ways involved in the inflammatory response. The main goal of the present work

is to elucidate the bilirubin molecular mechanism involved in the atheromatous

diseases that correlates with the previous epidemiological evidence.

52

Chapter 3

MATERIALS AND METHODS

3.1 Endothelial Cells

The vascular endothelium is a single layer of cells lining the inside face of all

blood vessels and constitute an important metabolic organ which is critically in-

volved in the generation and the regulation of multiple physiological and patho-

logical process such as inflammation, atherosclerosis and angiogenesis (Pratico,

2005).

Endothelial cells are dynamic and have both metabolic and synthetic func-

tions. They exert significant autocrine, paracrine and endocrine actions and influ-

ence smooth muscle cells, platelets and peripheral leucocytes (Cines et al., 1998).

The endothelium is sensitive to growth factors and exchanges messengers with

blood and sub-endothelium, the extracellular matrix and the smooth muscle cell

of the media in large vessels (Nathan & Sporn, 1991).

Even cells from the same part of the vasculature can have varied responses.

It is also important to note that responses of cultured endothelial cells may not

reflect responses seen in the same cells in vivo, and the immortalized endothelial

cell lines used in many laboratory studies may, in particular, have altered expres-

sion patterns of key markers compared with cells studied in vivo.

In the present study a murine microvascular endothelial cells (H5V) was used.

This cell line is a transformed endothelial cell line from heart mice with a retro-

53

Materials and Methods

Figure 3.1: Morphology of H5V cells in vitro. H5V 10X Normal Light

viral construct encoding polyoma middle-sized T antigen (Garlanda et al., 1994)

(Figure 3.1). To further confirm our data, a human umbilical vein endothelial cells

(HUVEC), isolated from the vein of the umbilical cord (Booyse et al., 1981; Jaffe

et al., 1973) (Figure 3.2) was also considered.

3.2 Materials

Unconjugated bilirubin (UCB)(Sigma Chemical Co, St. Louis MO), was pu-

rifeied as described by McDonagh and Assisi (McDonagh & Assisi, 1972). Dul-

becco’s Phosphate saline, Dulbecco’s modified Eagles’s medium high glucose

(DMEM/High glucose), penicillin and streptomycin were purchased from Euro-

clone U.K. and Fetal calf serum was obtained from Invitrogen Carlsbad, Califor-

nia.

Chloroform (99%) was obtained from Carlo Erba Milan, Italy. Fatty acid free

bovine serum albumin (BSA), tetrazolium salt (MTT), DMSO, TNF-α, and all

other reagents and chemicals were purchased from Sigma-Aldrich Italy Milan,

Italy.

54

3.3 UCB solutions

Figure 3.2: Morphology of HUVEC cells in vitro. HUVEC 40X Normal Light

3.3 UCB solutions

The free (unbound) plasma bilirubin concentration (Bf), a little fraction of total

bilirubin concentration, is the principal determinant of tissue uptake and toxicity.

However, methods to estimate the Bf from medium has rarely been performed

(Nelson et al., 1974; Jacobsen & Wennberg, 1974). Indeed, in most of the in vitro

studies of cellular toxicity the UCB levels were higher than those seen in physio-

logical and pathophysiological conditions (Ostrow et al., 2003b).

Recently, in our group the Bf bilirubin levels in tissue culture media were eval-

uated by a standardization of peroxidase method (Roca et al., 2006). The methods

involves minimal dilution of the sample, minimizing the effect of dilution of the

albumin concentration on the binding affinity (Ahlfors, 1981). The effects of albu-

min concentration on bilirubin-albumin binding measured were evaluated by the

peroxidase method in order to reproduce different physiologic Bf levels. The mo-

lar ratio of UCB and bovine serum albumin (BSA 30 µM) was tested in DMEM

high glucose in order to obtain variable doses of Bf (Figure 3.3). Similar results

were obtained with M199 medium used in HUVEC culture.

55


Figure 3.3: Relationship of Bf to UCB with three different albumin preparations.(N) FCS10%, (2) BSA 30 µM, (�) HSA 30 µM. Data represent the mean ±SD of three independentexperiments in triplicate. From (Calligaris et al., 2007)

56

3.4 Culture conditions

Purified UCB was dissolved in chloroform at a concentration of 0.85 mM

and aliquots were dried under nitrogen. Immediately before each incubation, an

aliquot was dissolved in DMSO (0.3 µL of DMSO per µg of UCB, and diluted

with serum free medium containing 30 µM bovine serum albumin (BSA).

Experiments were performed with two final UCB concentrations of 2.5 and

5 µM, yielding unbound UCB concentrations (Bf) calculated to be respectively

15 and 30 nM. In order to standardize DMSO-related effects, a further volume

of DMSO was added to the final solution to reach an equal total amount in all

treatment groups. To minimize photo-degradation, all the experiments with UCB

were performed under light protection (dim lighting and vials wrapped in tin foil).

3.4 Culture conditions

H5V cells were grown up to ∼80% of confluence in Dulbecco’s Modified Ea-

gle’s Medium High Glucose (DMEM) containing fetal calf serum (10% vol/vol),

penicillin (100 U/mL) and streptomycin (100 g/mL). After confluence cells were

washed three times with PBS and then incubate in six different combinations of

adducts:

• Control group: serum free medium containing BSA (30 µM) and DMSO

(0.29% v/v).

• TNF alone group: add TNFα 20 ng/mL, serum free medium, BSA, DMSO.

• UCB 15 alone: add UCB at Bf 15 nM, serum free medium, BSA, DMSO.

• UCB 30 alone: add Bf 30 nM, serum free medium, BSA, DMSO.

• Co-treatment UCB 15-TNF: add Bf 15 nM, TNFα 20 ng/mL, serum free

medium, BSA and DMSO.

• Co-treatment UCB 30-TNF: add Bf 30 nM, TNFα 20 ng/mL, serum free

medium, BSA and DMSO.

57


Human Umbilical Vein Endothelial Cells (HUVEC) were kindly gifted by

Prof. F. Tedesco from Dept. of Physiology an Pathology University of Trieste.

Cells were cultured in medium M199 with Hanks’ salt and NaHCO3 (SIGMA

M7653) enriched with fetal calf serum (20%), bovine cerebral extraction (50

µg/mL, gifted by Prof. F. Tedesco) (Maciag et al., 1979), Na-heparin (50 µg/mL,

EPSOCLAR, Biologici Italia Laboratory Srl, Milan, Italy), penicillin (100 U/mL)

and streptomycin (100 µg/mL). Cells were grown up on 25 cm 2 plastic flasks cov-

ered with gelatine (1%, SIGMA G-9391) in sterile bidistilled water (v/v). Cells

were used for experiments between the 4th and 6th cell passage. Cells were treated

in the same conditions as described previously for H5V cells.

3.4.1 Cytokines treatment

Cytokines represent a group of multi-functional substances that could be involved

in the initiation and amplification of the inflammatory process regulating the ex-

pression of many target genes. Human TNF-α, one of the pro-inflammatory cy-

tokine, was added to the culture in order to describe UCB contribution on its

effects. TNF-α time and dose response were determined as indicated in Table 4.2

and Table 4.3.

3.5 Endothelial cell susceptibility

In this part of the study, different endothelial susceptibility to UCB and TNF-α in

the two cell lines (HUVEC and H5V) was analyzed. The approaches used for this

point to test cytotoxicity were:

• assess of Lactate Dehydrogenase (LDH) release, to evaluate the presence

and degree of membrane damage;

• analysis of Mitochondrial Toxicity by MTT test (Liu et al., 1997).

3.5.1 LDH release test

Lactate dehydrogenase (LDH) is a stable cytoplasmic enzyme rapidly released

into the cell culture supernatant upon the damage of the plasma membrane (Hu &

58

3.5 Endothelial cell susceptibility

E., 1970).

The Cytotoxicity Detection Kit (LDH, ROCHE Applied Science, Penzberg,

Germany) was used to detect the cell damage. This kit allows to measure the LDH

activity by a colorimetric reaction. In the first step NAD+ is reduced to NADH/H+

by the LDH-catalyzed conversion of lactate to pyruvate. In the second step the

catalyst (diaphorase) transfers H/H+ from NADH/H+to the tetrazolium salt INT

(2-[4-iodophenyl]-3- [4-nitrophenyl]-5-phenyltetrazolium chloride) which is re-

duced to formazan. The formazan formed during the reaction is proportional to

the number of lysed cells and shows a maximum absorption at about 500 nm light

length.

The H5V monolayers cells were cultured on 24-well plates and treated for 24

hours, as indicated in the Table legend 4.1, with different UCB concentrations

with or without TNF-α (20 ng/mL).

The culture media was kept for this assay and cells were lysated with 1% Tri-

ton X-100. 50 µl of the supernatant and equal amount of the lysate cells were

incubated with the reaction mix for 20 minutes protected from light at room tem-

perature. The absorbance of the samples at 490 nm was determined in a LD 400C

Luminescence Detector (Beckman Coulter S.p.A, Milan, Italy). Results were ex-

pressed as percentage of the maximum amount of releasable LDH, obtained by

lysing cells.

3.5.2 Mitochondrial toxicity by MTT test

One of the most frequently used methods for measuring cell proliferation and cy-

totoxicity is the reduction of 3(4,5-dimethyltiazolyl-2)-2,5 diphenyl tetrazolium

(MTT), a monotetrazohum salt (Mosmann, 1983).

H5V and HUVEC cells were cultured on 24-well plates and treated for vari-

able periods of time, as indicated in the Figure legend 4.1, with different UCB

concentrations with or without TNF-α (20 ng/mL).

59


A stock solution of MTT was dissolved in PBS pH 7.4 at 5 mg/mL. MTT so-

lution was further diluted to 0.5 mg/mL in DMEM/High Glucose without phenol

red to avoid interference with the plate reading. Cells were incubated with DMEM

containing MTT for 2 hours at 37◦C. At the end of incubation period, the medium

was replaced with the addition of 1 ml isopropanol/HCL 0.04 M, to dissolve MTT

formazan crystals. Samples were then gently shacked in an orbital shaker for 2

hours at 37◦C. After centrifugation at 10,000 RPM for 3 min, absorbance values,

at a length light of 570 nm, were determined in a LD 400C Luminescence Detec-

tor (Beckman Coulter S.p.A, Milan, Italy). Results were expressed as percentage

of control cells, not exposed to UCB, which was considered as 100% viability.

3.6 Endothelial dysfunction analysis

The different markers for endothelial dysfunction were evaluated by:

• measurement of Nitric Oxide levels;

• gene expression analysis of the adhesion molecules and Nitric oxide Syn-

thase enzymes;

• protein expression analysis of the adhesion molecules.

3.6.1 Nitric oxide

Nitric oxide (NO) is unstable in an aerobic environment. The most commonly

employed methods for analysis of NO in aqueous solutions are the colorimetric

assays by Griess reagent. Through the years, modifications to the original reaction

described by Griess in 1879 have been reported (Nims et al., 1996; Cook et al.,

1996).

This methodology is based on the fact that free NO, reacts with oxygen to

yield reactive nitrogen oxide intermediates that can subsequently oxidize or ni-

trosate various substrates. In aerobic aqueous solution several stable and non-

volatile breakdown products can be detected, among them nitrate NO–3 and sub-

60


Figure 3.4: Chemistry of the Griess Reagent. Chemical reactions involved in the measurementof NO–

2 using the Griess Reagent system

sequently nitrite NO–2 (Green et al., 1982).

The colorimetric assay for evaluating NO concentration depends on the ni-

trosative properties of the NO intermediates NO–2 . The nitrosation of sulfamide by

acidic nitrite solutions in the presence of naphthylethylenediamine dihydrochlo-

ride (NEDD) results in an azo dye with absorption maximum at 540 nm light

length (Figure 3.4).

H5V and HUVEC cells were cultured on 6-well plates and treated for variable

periods of time, with different UCB concentrations with or without TNF-α (20

ng/mL) as indicate in Table 4.3 and Figure 4.2.

Culture media was kept for the assay, the absorbance was determined at 540

nm in a spectrophotometer Beckman DU 640 (Beckman Coulter S.p.A, Milan,

Italy). Values were compared against a standard curve with increasing concen-

trations of nitrite (1.56 to 100 µM). Cell lysates were stored for protein determi-

nation by Bicinchoninic Acid Protein Assay (BCA)(Smith et al., 1985) following

the procedure’s instructions (B-9643, SIGMA). Results were expressed as nmol

NO–2 mg/mL protein.

61


3.6.2 Gene expression analysis

RNA extraction

H5V and HUVEC cells were cultured on 6-well plates and treated for 2, 6 and

24 hours, with different UCB concentrations with or without TNF-α (20 ng/mL).

Total RNA was isolated by Tri Reagent solution according to the manufacture’s

suggestions (SIGMA, Missouri, USA. T9424). The total RNA concentration and

the purity were quantified by spectrophotometric analysis in a Beckman DU640.

For each sample the A260/A280 ratio comprised between 1.8 and 2.0 was con-

sidered as good RNA quality criteria. The integrity was determined by agarose

gel electrophoresis and staining with ethidium bromide, indicating that the RNA

preparations were of high integrity. Isolated RNA was dissolved in RNAse free

water and store at −80◦C until analysis.

mRNA Quantification by Real-Time RT-PCR

Expression analysis of target gene were performed by Real Time RT-PCR technol-

ogy, using specific primers for detection of the following markers of endothelial

dysfunction: eNOS, iNOS, ICAM-1, VCAM-1, E-selectin.

Retrotranscription using 1µg of total RNA was performed with an iScriptT M

cDNA Synthesis Kit (BIO-RAD Laboratories, Hercules, CA, USA Catalog # 170-

8891) according to the manufacture’s suggestions. The reaction was run in a Ther-

mal Cycler (Gene Amp PCR System 2400, Perkin -Elmer, Boston, MA, USA) at

25◦C per 5 min, 42◦C for 45 min, 85◦C for 5 min. The final cDNA was conserved

at −20◦C until used.

Real-time RT-PCR was performed according to the iQ SYBR Green Supermix

protocol (Bio-Rad Laboratories). The selected genes and their primer sequences

for mouse and human are reported in Table 3.1, and Table 3.2, respectively. The

primers were designed using Beacon Designer 4.02 software (PREMIER Biosoft

International, Palo Alto, CA, USA). All primer pairs were synthesized by Sigma

Genosys (Cambridgeshire, UK).

62


Table 3.1: H5V - Primer sequence designed for the mRNA quantification

Mouse - Gene Accession number Primer Forward Primer Reverse

eNOS NM 08713.2 GTGGAACAACTGGAGAAAGG AAGGAGGCGAGGACTAGG

iNOS NM 010927.1 TTGTGCGAAGTGTCAGTGG TCCTTTGAGCCCTTTGTGC

Icam-1 NM 010493.2 TCCGCTGTGCTTTGAGAAC GGTCCTTGCCTACTTGCTG

Vcam-1 NM 011693.2 GGGAGAGACAAAGCAGAAG GGAGTCACAGCCAATAGC

E-selectin NM 011345.1 GGTTCCTTCCTGCCAAGTG GCCATTGAGCGTCCATCC

βACTIN NM 007393.0 CCTTCTTGGGTATGGAATCCTGTG CAGCACTGTGTTGGCATAGAGG

PCR amplification was carried out in 25 µL reaction volume containing 25 ng

of cDNA, 1 x iQ SYBR Green Supermix (100 mM KCL; 40 mM Tris-HCl; pH:

8.4; 0.4 mM each dNTP; 50U/mL iTaq DNA polymerase; 6 mM MgCl2; SYBR

Green I; 20 mM fluorescein; and stabilizers)(BIO-RAD Laboratories) and 250 nM

gene specific sense and anti-sense primers and 100 nM primers for 18S. Reactions

were run and analyzed on a Bio-Rad iCycler iQ Real-Time PCR detection system

(iCycler IQ software, version 3.1; Bio-Rad).

Cycling parameters were determined, and resulting data were analyzed by us-

ing the comparative Ct method as means of relative quantification. The relative

quantification was made using the Plaffl modification of the ∆∆Ct equation (Pfaffl,

2001; Tichopad et al., 2004). The relative gene expression levels of each transcript

were determined by comparison with a standard curve. The genes were normal-

ized by dividing the expression value of a housekeeping gene βactin for H5V cells,

hypoxanthine guanine phosphoribosyltransferase (HPRT) and βactin for HUVEC

cells. Melting curve analysis and gel electrophoresis were performed to check

product specificity. Results reported as indicated in the Figure legends represent

the mean of 3 different experiments.

3.6.3 Western blot

H5V cells were treated as previosly described for 24 hours with different UCB

concentrations with or without TNF-α (20 ng/mL). Cells were then washed once

with PBS at room temperature and dissolved in cell lysis buffer, PBS containing

63


Table 3.2: HUVEC - Primer sequence designed for the mRNA quantification

Human - Gene Accession number Primer Forward Primer Reverse

eNOS NM 000603 CGGCGGAAGAGGAAGGAGTC CCACGGCACGAGCAAAGG

iNOS NM 000625.3 ATGACTCCCAGCACAAGG GCCATCTCCAGCATCTCC

ICAM-1 NM 000201 GCTTCGTGTCCTGTATGG CTGGCACATTGGAGTCTG

VCAM-1 NM 001078 GACCACATCTACGCTGAC GCAACTGAACACTTGACTG

E-selectin NM 000450 GGTTCCTTCCTGCCAAGTG GCCATTGAGCGTCCATCC

βACTIN NM 001101 CGCCGCCAGCTCACCATG CACGATGGAGGGGAAGACGG

HPRT NM 000194 CTGGAAAGAATGTCTTGATTGTGG TTTGGATTATACTGCCTGACCAAG

1% v/v of a protease inhibitor cocktail from Sigma (P-8340) and 2 mM PMSF

(phenylmethylsulfonylfluoride). Cells were placed on ice and disrupted by ultra-

sonic sonication (Bandelin Sonoplus, HD2070, Berlin, Germany; 3 times at 5 s at

30% of power).

Protein concentration in the lysate was determined by the Bicinchoninic Acid

Protein Assay (BCA)(Smith et al., 1985) following the instructions reported by

the supplier (B-9643, SIGMA).

Equal amounts of protein (60 µg) were subjected to sodium dodecyl sulphate-

polacrilamide gel electorphoresis (SDS-PAGE). Molecular weight standards (Pre-

cision Plus Protein dual color standards, Bio-Rad) were used as marker proteins.

Samples were immersed in a boiling water bath for 5 min and then immediately

settled on ice. Proteins were loaded on 10% polyacrylamide gel by electrophore-

sis in a Mini Protein III Cell (Bio-Rad, Hercules, CA, USA). After SDS-PAGE,

gels were electrotransferred with a semi-dry blotting system at 100 V for 120

min onto immune-blot PVDF membranes (Bio-Rad) using a Mini Trans-Blot Cell

(Bio-Rad).

Membranes were incubated overnight at 4◦C with commercial antibodies (Ta-

ble 3.3) that allow the specific recognition of Vcam-1 (Santa Cruz Biotechnology,

Inc., Santa Cruz, CA), Icam-1 (Santa Cruz Biotechnology), E-selectin (Santa Cruz

Biotechnology).

64


Table 3.3: Primary antibodies tested

Protein Primary Antibody Dilution

(Catalog #)

Vcam-1 sc-1504 1:500

Icam-1 sc-1511 1:500

E-selectin sc-14011 1:250

Actin A2066 1:2000

Antibodies were dissolved in a solution containing skim milk (5%) and T-

TBS buffer (Tris/HCL 20 mM, Tween 20, 0.2%, NaCl 500 nM, pH 7.5) at the

dilution reported in Table 3.3. After three washes with T-TBS, membranes were

incubated for 1 hour at room temperature with a secondary antibody (Sigma-

Aldrich Italy Milan, Italy). The following antibodies were used: IgG-anti-goat

(dilution 1:4000) for Vcam-1 or Icam-1 and IgG-anti-rabbit (dilution 1:1000) for

E-selectin, all conjugated with peroxidase.

Proteins bands were detected by peroxidase reaction and visualized by expo-

sure of membrane in the ECL-Plus Western Blot detection system solutions (ECL

Plus Western Blotting Detection Reagents, GE-Healthcare Bio-Sciences, Italy).

Membranes were incubated with a stripping buffer (0.5 mM Tris/HCl pH 6.8,

0.2 %v/v SDS, 0.68%v/v β-Mercaptoethanol) for 30 min at 55◦C followed by

overnight incubation with a commercial antibody specific for Actin recognition

(Table 3.3, SIGMA) according to the procedure previously described. After re-

peated washes, the membranes were incubated with secondary antibody IgG-anti-

rabbit peroxidase conjugated (dilution 1:5000), for 1 hour at room temperature.

The immunoreactivity was visualized as previously described, by ECL-Plus de-

tection kit.

The intensities of the autoradiographic bands were estimated by densitometric

scanning using NIH Image software (Scion Corporation Frederick, MD, USA).

65



The transcription factors involved in the expression of markers for endothelial

dysfunction were evaluated by:

• use of Inflammatory inhibitors (PDTC - NAC);

• evaluation of of CREB phosphorylation;

• assessment of NF-κB (p65 subunit) nuclear translocation.

To study the role of UCB on NF-κB pathway, cells were treated with PDTC

(Pyrrolidine dithiocarbamate) a specific inhibitor NF-κB. H5V cells were treated

for 2 hours with PDTC (10 µM) alone or with UCB, as described above, in the

presence or absence of TNF-α. Cells were pre-treated with PDTC 1 hour before

incubation with TNF-α. PDTC was dissolved in serum free medium on the day

of treatment. Cells were then collected and the mRNAs were extracted. The ex-

pression of AMs was evaluated by Real Time RT-PCR.

UCB effects on NO levels were also evaluated after 24 hours treatment with

NAC in the same culture conditions described previously. NAC solution was

freshly prepared on the day of treatment and adjusted to pH 7.4 by the addition of

8 M NaOH. NAC dose response were determined as indicate in Figure legends 4.5.

3.7.1 cAMP-response element(CRE)-binding protein (CREB)

The H5V monolayers cells were cultured on 6-well plates and pre-treated for vari-

able periods of time, as indicated in the Figure legends 4.21, with different UCB

concentrations with or without TNF-α (20 ng/mL). Proteins were collected and

a gel electrophoresis (SDS-PAGE) was performed as described in Western Blot

section.

The phosphorylated CREB at Ser 133 was detected by the PhosphoPlus CREB

antibody Kit (Catalog # 9190, Cell Signaling). The kit allowed the specific recog-

66


nition of the phosphorylation status of CREB at serine 133. Phospho-CREB spe-

cific antibody was used (dilution 1:500). The membranes were reprobed with an

antibody against total CREB (recognized phosphorylated and non phosphorylated

form) (dilution of 1:500). Secondary antibody IgG-anti-rabbit (dilution 1:1000)

conjugated with peroxidase was used. All antibodies were analyzed by the same

procedure previously described.

3.7.2 Preparation of total nuclear extracts

The total cytoplasmic and nuclear extracts were obtained by using minor modifi-

cation of the Dignam’s method (Dignam et al., 1983). H5V cells were seeded at

a density of 5x107 on 75− cm 2 flasks and were treated with different UCB con-

centrations with or without TNF-α (20 ng/ml) for 30 minutes.

After treatment, the cells were collected by centrifugation at 800Xg for 10

min. The cells were resuspended in 400 µL cells ice-cooled solution A (10 mM

Hepes, pH 7.9, 0.1 mM MgCl2, 10 mM KCl, 0.1 mM EDTA, pH 8, 0.1 mM

dithiotreitol, 0.5 mM phenylmethylsulphonyl fluoride, 1 mM Na orthovanadate

and 1 mM Na Fluoride). After 10 min ice incubation the cells were centrifuged at

800Xg for 5 min at 4◦C. The supernatant containing the cytoplasm was collected

and stored at −80◦C. The pellet containing nuclei was resuspended with solution

A and was centrifugated at 800Xg for 5 min at 4◦C. The nuclear fraction was

resuspended in ice-cooled solution B (20 mM Hepes, pH 7.9, 420 mM NaCl, 1.5

mM MgCl2, 0.2 mM EDTA, 5% glycerol, 0.1 mM dithiotreitol, 0.5 mM phenyl-

methylsulphonyl fluoride, 1 mM Na orthovanadate and 1 mM Na Fluoride). After

30 min ice incubation with constant stirring, the suspension was vortexed for 10

s, then centrifuged at 15,000Xg for 20 min at 4◦C. The supernatant containing

nuclear extract was recovered and stored at −80◦C.

The protein content of the extracts was determined by BCA method as de-

scribed before. The nuclear and cytoplasmic extract fractions were analyzed by

SDS-page Western Blot.

67


Commercial antibody that allow the specific recognition of NF-κB p65 sub-

unit(Catalog # SC-109, dilution 1:1000, Santa Cruz Biotechnology, Santa Cruz,

CA, USA) was used. To test nuclear enrichments, the presence of a nuclear matrix

protein p84 (Catalog # ab487, dilution 1:1000, Abcam, Abcam Inc., Cambridge,

MA, USA) was evaluated as marker (Portal et al., 2006). Secondary antibodies

conjugated with peroxidase (both from Sigma-Aldrich) IgG-anti-rabbit (dilution

1:2000), for NF-κB, and IgG-anti-mouse (dilution 1:2000), for p84, were used.

Both antibodies were analyzed by the same procedure previously described on

Western blot section.

3.8 Statistical analysis

All experiments were run in triplicate and repeated three times. Results are ex-

pressed as mean±SD. Oneway ANOVA with Tukey-Kramer post test was per-

formed using GraphPad InStat version 3.00 for Windows 95 (GraphPad Software,

San Diego, CA, USA). Probabilities, ≤ 0.05 were considered statistically signifi-

cant.

68

Chapter 4

RESULTS

4.1 Effects of UCB on cell viability

Bilirubin has been found to be toxic to many cell examined in vitro, including fi-

broblasts (Nelson et al., 1974), hepatocytes, erytrocytes, leukcocytes, liver (Czer-

nobilsky & Dubin, 1965), HeLa (Shimabuku & Nakamura, 1983) and platelets(Amit

et al., 1992).

The effect of UCB and TNF-α on endothelial cell viability was evaluated.

Two different methods to analyzes cell viability were used, Lactate Dehydroge-

nase (LDH) release and Mitochondrial Toxicity (MTT) assay.

4.1.1 UCB did not affect the LDH release induced by TNF-α

The plasma membrane integrity was unchanged in presence of different doses of

UCB (Bf, 15, 30 and 100 nM). As expected, the addition of TNF-α (20 ng/mL)

significantly increased the extracellular LDH activity. However, no further effects

were observed when co-treatment TNF-α plus UCB were performed. Table 4.1

summaries the results obtained in H5V cells.

4.1.2 UCB reduced endothelial cell viability

Based on the negative results of LDH and since MTT assay was demonstrated

to be a method more suitable for studying bilirubin cytotoxicity in a human liver

69

Results

LDH release (%)UCB (Bf nM) - TNF-α + TNF-α

Control 14.9±1.60 26.8±1.3∗

15 15.2±1.3 23.1±1.9∗

30 14.6±1.8 23.4±1.7∗

100 15.5±0.2 22.13±0.8∗

Table 4.1: Effect of UCB on cell viability - LDH release. H5V cells were incubated with dif-ferent doses of UCB (Bf 15, 30 and 100 nM), with or without treatment with TNF-α. Control cells(UCB, Bf 0 nM) were treated as described in Materials and Methods. Cells were collected after 24h of treatment, LDH released (%) into the cell medium was calculated. Results are expressed asmean percentage values (%) of three independent experiment performed in triplicate. *: p< 0.05versus control.

cell line (Ngai et al., 1998), H5V cells were exposed to different doses of UCB

(Bf 15, 30 and 100 nM) with or without TNF-α (20 ng/mL) for 24 hours. Con-

trol cells were treated as described in Materials and Methods. UCB significantly

decreased H5V vitality in a dose-dependent manner (Figure 4.1, D). However,

the co-treatment with TNF-α(20 ng/ml) did not modify UCB effects. Same re-

sults were obtained when cells were exposed to UCB with or without TNF-α (20

ng/ml) for 48 hours (data not shown).

In order to verify UCB effects on endothelial cell viability, HUVEC cells were

treated with different doses of UCB (Bf 15, 30 and 100 nM) with or without TNF-

α (20 ng/mL) for 2, 6 and 24 hours. Similarly to H5V cells, UCB was able to

reduce endothelial cell viability in a dose dependent manner at 2 and 6 hours (Fig-

ure 4.1, A and B). Treatment for 24 hours greatly decreased the cell viability even

in control cells (Figure 4.1, C). Indeed, HUVEC cells have an initial reduction on

cell viability, even at 2 and 6 hours, due to the absence of fetal calf serum and

bovine cerebral extraction, conditions of control group (UCB, Bf 0 nM). This ini-

tial reduction of cell viability was significantly increased by treatment with TNF-α

alone. However, once UCB was add to the cell medium culture, co-treatment with

TNF-α(20 ng/mL) did not cause further effects.

70

4.2 Nitric oxide analysis

TNF-α NO(ng/mL) (NO–

2 nmol/mg protein)

0 5.0±0.80

2.5 4.4±0.16

5 4.4±0.30

10 4.2±0.60

20 3.5±0.35∗

40 3.6±0.34∗

Table 4.2: Effect of different doses of TNF-α on NO production. H5V cells were incubatedwith different doses of TNF-α (0, 2.5, 5, 10, 20, 40 ng/mL). Cells were collected after 24 h oftreatment. Results are expressed as NO–

2 nmol/mg protein and represent means±SD, n=3. *: p<

0.05 versus control group (TNF-α 0 ng/mL).

Based on these results, in the following experiments we decided to removed

the treatment with high doses of UCB (Bf 100 nM), in order to avoid excessive

loss of cell survival. To summarize, UCB reduced in a dose dependent manner

the cell viability in both cell lines. UCB toxicity was manifested by impaired

mitochondrial function (MTT activity). However, UCB did not cause change in

the cellular permeability or necrosis, base on LDH release assay.


The effect of increasing concentrations of TNF-α on NO production in H5V cells

was evaluated. While TNF-α up to a concentration of 10 ng/mL did not influence

the NO production at 24 hours, when the concentration was over 20 a significant

decreased on the NO concentration in the cell medium was observed. Table 4.2

summaries the results obtained in H5V cells.

On the other hand, the secretion profile of NO to cell medium, in cells treated

with or without TNF-α (20 ng/mL) was also evaluated. A time depended NO

basal increased was reveled. The NO reduction with TNF-α was seen at all times

studied (12h 86%, 24h 76% and 48h 78%, p< 0.05). Table 4.3 summaries the

results obtained in H5V cells.

71

Results

Figure 4.1: Effect of UCB on cell viability - MTT assay. HUVEC (A, B and C) and H5V cells(D) were incubated with different doses of UCB (Bf 15, 30 and 100 nM), with or without TNF-α.Control cells (UCB, Bf 0 nM) were treated as described in Materials and Methods. Results areexpressed as mean percentage values (%) of three independent experiment performed in triplicate.*: p< 0.05 versus control. #: p< 0.05 versus complete medium.

72


NO (NO–2 nmol/mg protein)

Hours - TNF-α + TNF-α12 9.53±0.80 8.20±0.6∗

24 7.93±0.1 6.10±0.9∗

48 14.72±0.8 11.54±0.13∗

Table 4.3: Time dependent effect of TNF-α on NO production. H5V cells were incubatedwith TNF-α (20 ng/mL) for 12, 24 and 48 hours. Cell medium was collected after treatment. Re-sults are expressed as NO–

2 nmol/mg protein and represent means±SD, n=3. *: p< 0.05 comparedto respective cells without TNF-α.

4.2.1 Effect of UCB on NO levels in H5V cells

To study the putative role of UCB in NO concentration, nitrite (NO–2 ) production

in culture supernatant was measured. Treatments with UCB at two different under-

saturation concentrations of free bilirubin (Bf 15 and 30 nM) with or without

TNF-α (20 ng/mL), for 24 and 48 hours were performed. The time periods (24

and 48 hours) were considering eNOS half life, which is about 20 hours (Govers &

Rabelink, 2001). As demonstrated before, TNF-α at a concentration of 20 ng/mL,

significantly reduces nitrite levels. The significant reductions of nitrite content,

by treatments with TNF-α (20 ng/mL), was not reversed by the presence of any

doses of UCB after treatments for 24 hours (Figure 4.2, A). Interestingly, the

significant reductions of nitrite content in culture supernatant induced by TNF-α

was reversed after 48 hours by the presence of UCB, either a Bf of 15 or 30 nM

(Figure 4.2, B).

4.2.2 Effect of UCB on NOS mRNA expression

We investigated, by Real Time RT-PCR, whether or not UCB modifies the gene

expression of the two Nitric Oxide Synthases (NOS), constitutive (eNOS) and in-

ducible form (iNOS) in endothelial cells.

The expression of eNOS was not influenced by the treatment with TNF-α (20

ng/mL) at 2, 6 and 24 hours (Figure 4.3, A). On the other hand, the addition of

TNF-α (20 ng/mL) increased the expression of iNOS at 2, 6 and 24 hours (Figure

73

Results

Figure 4.2: Effect of different doses UCB on NO production. H5V cells were incubatedwith different doses of UCB (Bf 15 and 30 nM), with or without TNF-α. Control cells (UCB,Bf 0 nM) were treated as described in Materials and Methods. Cell medium was collected after24 h (A) or 48 h (B) of treatment for NO–

2 levels determination. Results are expressed as meanpercentage values (%)±SD of control cell group, from three independent experiment performedin triplicate.*: p< 0.05 versus control. #: p< 0.05 versus TNF-α alone group (UCB, Bf 0 nM plusTNF-α).

74


4.3, B).

Co-treatments with TNF-α and UCB (Bf 15 nM) determined a slightly but sig-

nificant reduction of mRNA expression at 2 hours (74%, p< 0.05). However, no

effect was seen in treatments with UCB alone. Interestingly, at 24 hours, the co-

treatment with both UCB (Bf 15 and 30 nM) and TNF-α was able to increase the

levels of iNOS expression (160% and 126%, respectively) if compared to TNF-α

alone (considered as 100%) treatments (Figure 4.4).

According to this data we can postulate that UCB is able to modulate the

TNF-α effect on the induction of iNOS expression while as well as TNF-α, UCB

has been shown not be involved in the regulation of eNOS. These results suggest

that iNOS expression is affected by UCB treatments in biphasic regulation, which

could modify NO concentration at 48 hours. Such mechanism would constitute

a self-regulating pathway by which NO production from this NOS could be fine-

tuned (Schwartz et al., 1997; Bogdan, 2001a).

4.2.3 NO levels in HUVEC cells

The same experiments were conducted in HUVEC cells. The NO levels were

undetectable by Griess’ assay. This result was also confirmed by an ion chro-

matography with suppressed conductivity detection (data not shown). Indeed, no

effects of either TNF-α (Table 4.4) or UCB (data not shown) were seen on eNOS

expression. Moreover, the mRNA expression of iNOS evaluated by Real Time

RT-PCR was undetectable in all the experimental conditions described in Materi-

als and Methods.

4.2.4 UCB, the redox status and NO levels

ROS levels can be considered as molecular second messengers that could activate

or inhibit cell functioning depending on the intensity and duration of the oxidative

stress produced in the cell. As described previously, NO levels result from an im-

balance between the synthesis and consumption. The quenching of NO by ROS

lead to the formation of reactive nitrogen species (Endemann & Schiffrin, 2004;

75

Results

Figure 4.3: TNF-α induces iNOS gene expression in H5V cells. Effect of TNF-α (20 ng/mL)on eNOS (A) and iNOS (B) mRNA gene expression on H5V cells at 2, 6 and 24 hours. Bars repre-sent fold of expression, obtained by real time RT-PCR, compared to control cells and normalizedto β-actin used as housekeeping gene. Results are representative of three independent experiments.Values are mean ±SD. *: p< 0.05 versus control group.

76


Figure 4.4: Effect of UBC on TNF-α-induced iNOS gene expression in H5V cells. Effect ofdifferent doses of UCB (15 and 30 nM) with or without TNF-α (20 ng/mL) on H5V cells. Cellswere collected after 2, 6 and 24 h and the relevant, specific mRNAs were analyzed by Real TimeRT-PCR. Results are expressed as mean percentage of folds of expression (%), related to TNF-α(20 ng/mL) alone treatment, ±SD, n=3. *: p< 0.05 versus TNF-α alone treatment group.

77

Results

eNOS expressionHours - TNF-α + TNF-α

2 25.30±0.14 24.80±0.10

6 24.00±0.20 24.25±0.10

24 25.85±0.20 26.90±0.10

Table 4.4: Threshold cycle values of eNOS in HUVEC cells. Effect of TNF-α (20 ng/mL) oneNOS mRNA gene expression in HUVEC cells at 2, 6 and 24 hours. Values are a representative setof mean±SD threshold cycle values (Ct) obtained by Real Time RT-PCR reaction from samplesin triplicate. Data represent control group cells at 2, 6 and 24 hours.

Madamanchi et al., 2005).

In order to verify if the UCB effects on NO production were influences by

ROS, a set of experiments using NAC, a well known antioxidant, were done as

described in Materials and Methods. Nitrite (NO–2 ) production in culture super-

natant was measured as described before. iNOS and eNOS expression, were eval-

uated by Real Time RT-PCR.

H5V cells were incubated for 2 hours with TNF-α (20 ng/mL) with or with-

out NAC (10 mM). As expected, the expression of eNOS was not influenced by

TNF-α or NAC treatment (Figure 4.5, A). However, TNF-α induction on iNOS

mRNA expression was reverted in a dose-dependent manner by NAC. Moreover,

treatment with NAC 5 mM completely abolished TNF-α effects (Figure 4.5, B).

As previously established, TNF-α (20 ng/mL), significantly reduces nitrite

levels. In addition, significant reductions of nitrite content, was also observed af-

ter treatment with NAC (10 mM) alone. Interestingly, an additive inhibitor effect

was observed by co-treatments with TNF-α and NAC (Figure 4.6, A). These re-

sults can partially be explained by the regulation of iNOS expression. Treatments

with TNF-α (20 ng/mL) induced iNOS mRNA, as demonstrated before. However

when NAC, alone or in co-treatment with TNF-α, was added to the cell medium

a significant reduction of the iNOS expression was observed (Figure 4.6, B).

78


Figure 4.5: NAC reverted TNF-α effects on iNOS gene expression. H5V cells were incubatedwith different doses of NAC (50, 20, 10 and 5 mM) with or without TNF-α (20 ng/mL). eNOS (A)and iNOS (B) mRNAs gene expression were evaluated after 2 hours of treatment. Bars representfold of expression, obtained by Real Time RT-PCR, compared to control cells and normalized toβ-actin used as housekeeping gene. Results are representative of two independent experiments.Values are mean±SD.

79

Results

Genes 2h 6h 24h

E-selectin 23.03±0.05 23.23±0.23 23.07±0.15

Vcam-1 27.97±0.11 28.63±0.05 28.47±0.11

Icam-1 27.87±0.15 28.80±0.17 28.97±0.05

Table 4.5: Threshold cycle values of genes studied in H5V control cells. Values are a rep-resentative set of mean±SD threshold cycle values (Ct) obtained by Real Time RT-PCR reactionfrom samples in triplicate. Data represent control group cells at 2, 6 and 24 hours.

Interestingly, the significant reduction of iNOS expression, induced by TNF-

α, was additively reversed by the presence of UCB (at Bf of 15 nM) and NAC,

after 2 hours (Figure 4.7).

4.3 UCB reduced AM expression induced by TNF-α

4.3.1 H5V cells - mRNA relative expression

In order to characterize unconjugated bilirubin (UCB) effects on adhesion mol-

ecules (AM) gene expression, mRNAs levels were quantified by Real Time RT-

PCR. H5V cells were incubated for 2, 6 and 24 hours with TNF-α (20 ng/mL), as

described.

As expected, TNF-α alone engendered a significant increase of all three AM

genes at 2, 6 and 24 hours, with lower, but still elevated mRNA levels at 24 hours

(Figure 4.8). In addition, no changes were observed in control cells group at dif-

ferent time points. Table 4.5 summaries the threshold cycle (Ct) values of AM

genes studied in the control cell group.

Therefore, later experiments were designed to evaluate the direct role of phys-

iological doses of UCB in co-treatment with TNF-α, as previously described.

Co-treatment with UCB (Bf 15 and 30 nM), significantly blunted the TNF-α-

induced expression of E-selectin at 2h by 31% and 43% (respect to TNF-α alone

group, considered as 100%; p<0.05). However, no statistically significant differ-

80


Figure 4.6: Effect of NAC on NO production. H5V cells were incubated with NAC (10 mM),with or without TNF-α. Control cells were treated as described in Materials and Methods. Cellmedium was collected after 24 h of treatment for NO–

2 levels determination. Results are expressedas NO–

2 nmol/mg protein and represent means±SD, n=3. (A) *: p< 0.05 compared to respectivegroup. (B) *: p< 0.05 versus control group. #: p< 0.05 versus TNF-α alone treatment group. &:p< 0.05 versus NAC alone treatment group.

81

Results

Figure 4.7: TNF-α induction of iNOS gene expression was reverted by UBC and NAC.Effect of different doses of UCB (Bf 15 and 30 nM) with NAC (10 mM) on H5V cells. Cells wereincubated with TNF-α (20 ng/mL) and collected after 2 h of treatment. The mRNAs were analyzedby Real Time RT-PCR. Results are expressed as mean percentage of folds of expression (%),related to TNF-α (20 ng/mL) alone treatment, ±SD. *: p< 0.05 versus TNF-α alone treatmentgroup. &: p< 0.05 versus NAC alone treatment group.

82


Figure 4.8: TNF-α induces AM gene expression in H5V cells. Effect of TNF-α (20 ng/mL) onAM mRNAs gene expression in H5V cells at 2, 6 and 24 hours. Bars represent fold of expression,obtained by Real Time RT-PCR, compared to control cells and normalized to β-actin used ashousekeeping gene. Results are representative of three independent experiments. Values are mean±SD. *: p< 0.05 versus control group.

83

Results

ences were recorded at 6 and 24 hours (Figure 4.9).

TNF-α-induced Vcam-1 gene expression was significantly blunted by 28%,

by co-treatment with UCB 15 nM at 2 hours (p<0.05) and by 28% & 35% with

UCB 15 nM and 30 nM at 6 hours (p<0.05); no differences were observed at 24

hours (Figure 4.10).

Interestingly, the induction of Icam-1 gene expression by TNF-α was not af-

fected by co-treatment with UCB over any time period (Figure 4.11). It should be

noted that the gene expressions of all genes studied were not modified when cells

were treated with UCB alone at both concentrations.

4.3.2 HUVEC cells - mRNA relative expression

Further experiments were done in order to assess whether UCB also regulated the

adhesion molecules mRNA expression on HUVEC cells.

Adhesion molecules mRNA levels gene expression were analyzed by Real

time RT-PCR. HUVEC cell were incubated for 2, 6 and 24 hours with different

doses of UCB (Bf 15 and 30 nM) with or without TNF-α (20 ng/mL), as previ-

ously described.

The results were similar to those observed in H5V cells. TNF-α alone de-

termined a significant increase of E-selectin, VCAM-1 and ICAM-1 at all times

studied, respect to the control group (Figure 4.12, 4.13, 4.14). Moreover, mRNA

gene expression was unchanged in control cells at all time points (data not shown).

Indeed, no significant changes in AM gene expression were seen in UCB treat-

ment alone (data not shown).

TNF-α induced over-expression (considered as the 100%) of E-selectin. This

was blunted 25–30% by co-treatment with either dose of UCB (Bf 15 and 30 nM)

at 2 and 6 h (p< 0.05) but the 20% reduction at 24 hours was not significant (Fig-

ure 4.12).

84


Figure 4.9: Effect of UBC on TNF-α-induced E-selectin gene expression in H5V cells. Effectof different doses of UCB (Bf 15 and 30 nM) with or without TNF-α (20 ng/mL) on H5V cells.Cells were collected after 2, 6 and 24 h and the relevant, specific mRNAs were analyzed by RealTime RT-PCR. Results are expressed as mean percentage of folds of expression (%), related toTNF-α (20 ng/mL) alone treatment, ±SD. *: p< 0.05 versus control group. #: p< 0.05 versus

TNF-α alone treatment group.

85

Results

Figure 4.10: Effect of UBC on TNF-α-induced Vcam-1 gene expression in H5V cells. Effectof different doses of UCB (Bf 15 and 30 nM) with or without TNF-α (20 ng/mL) on H5V cells.Cells were collected after 2, 6 and 24 h and the relevant, specific mRNAs were analyzed by RealTime RT-PCR. Results are expressed as mean percentage of folds of expression (%), related toTNF-α (20 ng/mL) alone treatment, ±SD. *: p< 0.05 versus control group. #: p< 0.05 versus


86


Figure 4.11: Effect of UBC on TNF-α-induced Icam-1 gene expression in H5V cells. Effectof different doses of UCB (Bf 15 and 30 nM) with or without TNF-α (20 ng/mL) on H5V cells.Cells were collected after 2, 6 and 24 h and the relevant, specific mRNAs were analyzed by RealTime RT-PCR. Results are expressed as mean percentage of folds of expression (%), related toTNF-α (20 ng/mL) alone treatment, ±SD. *: p< 0.05 versus control group.

87

Results

By contrast, TNF-α induced over-expression of VCAM-1 was decreased 20–

25% by co-treatment with UCB (Bf 15 and 30 nM) only at 6 hours (p< 0.05,

Figure 4.13).

Interestingly, unlike H5V cells, the ICAM-1 gene over expression caused by

TNF-α treatment (D) was blunted by UCB co-treatment (40% for Bf 15 nM and

48% for Bf 30 nM) at 6 h (p< 0.05), but not at 2 or 24 hours (Figure 4.14).

4.4 AM protein expression

H5V cells were harvested after 24 hours treatment under the different conditions

as described in Materials and Methods. AM protein expression was determined

by SDS-PAGE Western Blot analysis.

TNF-α was able to induce protein expression of E-selectin (Figure 4.15),

Vcam-1 (Figure 4.16) and Icam-1(Figure 4.17), in a time-dependent manner, con-

firming data previously obtained from other endothelial cells (Cook-Mills & Deem,

2005).

When cells were treated with TNF-α and UCB for 24 hours, the protein ex-

pression was reduced if compared with TNF-α treatment alone (Figure 4.18).

Similar results were obtained at 6 hours of treatment, whereas not significant dif-

ferences were observed (data not shown). Moreover, UCB alone, at Bf of 15 and

30 nM did not affect protein expression (data not shown).

Due to the low antibodies cross-reactivity observed, protein profiles in HUVEC

cells were unable to be obtained.

88


Figure 4.12: Effect of UBC on TNF-α-induced E-selectin gene expression in HUVEC cells.Effect of different doses of UCB (Bf 15 and 30 nM) with or without TNF-α (20 ng/mL) on HUVECcells. Cells were collected after 2, 6 and 24 h and the relevant, specific mRNAs were analyzed byreal time RT-PCR. Results are expressed as mean percentage of folds of expression (%), relatedto TNF-α (20 ng/mL) alone treatment, ±SD. *: p< 0.05 versus control group. #: p< 0.05 versus


89

Results

Figure 4.13: Effect of UBC on TNF-α-induced VCAM-1 gene expression in HUVEC cells.Effect of different doses of UCB (Bf 15 and 30 nM) with or without TNF-α (20 ng/mL) on HUVECcells. Cells were collected after 2, 6 and 24 h and the relevant, specific mRNAs were analyzed byReal Time RT-PCR. Results are expressed as mean percentage of folds of expression (%), relatedto TNF-α (20 ng/mL) alone treatment, ±SD. *: p< 0.05 versus control group. #: p< 0.05 versus


90


Figure 4.14: Effect of UBC on TNF-α-induced ICAM-1 gene expression in HUVEC cells.Effect of different doses of UCB (Bf 15 and 30 nM) with or without TNF-α (20 ng/mL) on HUVECcells. Cells were collected after 2, 6 and 24 h and the relevant, specific mRNAs were analyzed byReal Time RT-PCR. Results are expressed as mean percentage of folds of expression (%), relatedto TNF-α (20 ng/mL) alone treatment, ±SD. *: p< 0.05 versus control group. #: p< 0.05 versus


91

Results

Figure 4.15: TNF-α induces E-selectin protein expression in H5V cells. Cells were treatedwith TNF-α (20 ng/mL) for the indicated time periods. Total cell lysates were analyzed by Westernblot with specify antibody as described in Materials and Methods. Western blot analysis shownare normalized by Actin. The density of the specific band was scanned and quantified with animaging analyzer. Results indicate the fold of increase of one representative of three reproducibleexperiments per treatment group.

92


Figure 4.16: TNF-α induces Vcam-1 protein expression in H5V cells. Cells were treated withTNF-α (20 ng/mL) for the indicated time periods. Total cell lysates were analyzed by Westernblot with specify antibody as described in Materials and Methods. Western blot analysis shownare normalized by Actin. The density of the specific band was scanned and quantified with animaging analyzer. Results indicate the fold of increase of one representative of three reproducibleexperiments per treatment group.

93

Results

Figure 4.17: TNF-α induces Icam-1 protein expression in H5V cells. Cells were treated withTNF-α (20 ng/mL) for the indicated time periods. Total cell lysates were analyzed by Westernblot with specify antibody as described in Materials and Methods. Western blot analysis shownare normalized by Actin. The density of the specific band was scanned and quantified with animaging analyzer. Results indicate the fold of increase of one representative of three reproducibleexperiments per treatment group.

94


Figure 4.18: Effect of UBC on protein expression of three AM in H5V cells treated withTNF-α. Bilirubin reduces the TNF-α protein induction of E-selectin (A), Vcam-1 (B) and Icam-1(C) at 24 hours. Western blot analysis shown are normalized by Actin. The density of the specificband was scanned and quantified with an imaging analyzer. Results indicate the fold of increaseof one representative of three reproducible experiments per treatment group.

95

Results

4.5 UCB effects via NF-κB pathway

4.5.1 UCB and PDTC inhibit gene over-expression in an addictive pattern

H5V cells from all experimental groups were pre-treated with PDTC to specif-

ically inhibit the NF-κB pathway. The AM and iNOS mRNAs were measured

by Real Time RT-PCR after 2 hours of treatment, as described in Materials and

Methods.

PDTC effects seams not to be dose related mediated (Figure 4.19). The ad-

dition of PDTC (10 µM) caused a significant reduction in gene over-expression

induced by TNF-α for iNOS (46%), E-selectin (73%), Vcam-1 (80%) and Icam-1

(24%) mRNA (respect TNF-α alone considered as 100%, p< 0.05 Figure 4.20).

An additive inhibition of the expression of E-selectin gene, was seen upon

addition of UCB at either 15 or 30 nM Bf (55%, 46%, p< 0.05). The additive

inhibition by UCB of Vcam-1 gene expression was significant only at a Bf of 30

nM (56%, p< 0.05). Indeed, the additive inhibition on iNOS gene expression was

significant only at a Bf of 15 nM (40%, p< 0.05) (Figure 4.20).

The definition of an “additive effect” was concluded only when the sum of

the individual inhibitions by UCB and PDTC did not differ statistically from the

experimentally-measured inhibition obtained by combined treatment with UCB

and PDTC (Kuldo et al., 2005). The combinatory addictive theorically expected

effect was equal to the observed addictive effect on iNOS, E-selectin and Vcam-1

gene expression at Bf 30 nM and for also at Bf 15 nM for E-selectin. Icam-1

gene induction by TNF-α was not further inhibited by the addition of UCB to the

treatment PDTC.

4.5.2 CREB phosphorylation is not influenced by UCB

To investigate whether CREB is inactivated by UCB, western blot analysis was

performed by using an antibody that recognizes the phosphorylated form of CREB

96


Figure 4.19: PDTC inhibits the TNF-α AM and iNOS mRNA gene over-expression. H5Vcells were incubated with different doses of PDTC (250, 100, 50, 10 and 5 µM) with or withoutTNF-α (20 ng/mL). E-selectin, Vcam-1, Icam-1 and iNOS specific mRNAs were evaluated after 2hours of treatment. Bars represent fold of expression, obtained by Real Time RT-PCR, comparedto control cells and normalized to β-actin as housekeeping gene. Results are representative of twoindependent experiments. Values are mean±SD.

97

Results

Figure 4.20: UCB and PDTC inhibit, in an addictive pattern, the gene over-expression ofAM and iNOS induced by TNF-α. Effect of different doses of UCB (Bf 15 and 30 nM) with orwithout TNF-α (20 ng/mL) and PDTC (10 µM) on H5V cells. Cells were collected after 2 hoursof treatment and the relevant, specific mRNAs were analyzed by Real Time RT-PCR. Results areexpressed as mean of folds of expression, related to TNF-α (20 ng/ml) alone treatment, ±SD. *:p< 0.05 versus TNF-α alone treatment group. #: p<0.05 versus TNF-α and PDTC treatmentgroup.

98


Figure 4.21: Time dependent induction of CREB phosphorylation by TNF-α in H5V cells.CREB was detected by Western blot analysis using a phospho-specific and total CREB antibody.Cells were incubated with TNF-α(20 ng/mL) for 0, 5, 15, 30, 60, 120 and 240 minutes. Thedensity of the specific band was scanned and quantified with an imaging analyzer. The ratioof phosphorylated CREB to total CREB in TNF-α stimulated cells is shown as the relative foldincrease compared with that in un-stimulated cells. Results indicate the fold of increase of onerepresentative of two reproducible experiments per treatment group.

at Ser 133 and an antibody that recognizes both forms of CREB. Phosphoryla-

tion of CREB was significantly increased in a time dependent manner by TNF-α

alone, with a maximum increase reached after 15 min (Figure 4.21). UCB did not

affected CREB phosphorylation whether cells were treated with UCB alone or in

co-treatment with TNF-α (Figure 4.22).

4.5.3 NF-κB nuclear translocation is inhibited by UCB

It was also investigated whether the NF-κB translocation to the nucleus was inhib-

ited by UCB (Bf 15 and 30 nM). Cytoplasmic and nuclear localization of the p65

NF-κB subunit were evaluated by Western blot. As reported, TNF-α stimulated

p65 NF-κB nuclear translocation (Baeuerle, 1998a; May & Ghosh, 1998). UCB

alone did not affected p65 translocation (data not shown). On the contrary, when

cells were co-treated with UCB and TNF-α, the p65 nuclear translocation induced

by TNF-α was prevented by UCB in a dose dependent manner. Furthermore, the

co-treatment with UCB and TNF-α caused an increase of the cytoplasmic fraction

of p65 compared to control and to treatment with TNF-α alone (Figure 4.23).

99

Results

Figure 4.22: UBC does not affect CREB phosphorylation in H5V cells. CREB was detectedby Western blot analysis using a phospho-specific and total CREB antibody. Cells were incubatedwith UCB (Bf 15 and 30 nM) with or without TNF-α (20 ng/mL) for 15 minutes. The density of thespecific band was scanned and quantified with an imaging analyzer. The ratio of phosphorylatedCREB to total CREB in TNF-α stimulated cells is shown as the relative fold increase comparedwith that in un-stimulated cells. Results indicate the fold of increase of one representative of tworeproducible experiments per treatment group.

100


Figure 4.23: UCB inhibits TNF-α-induced nuclear translocation of NF-κB in H5V cells.Panel A) TNF-α stimulates translocation of NF-κB from cytoplasm to nucleus, which is inhibitedby UCB. NF-κB was detected by Western blot analysis using a p65 NF-κB antibody after 30minutes of incubation with TNF-α and/or UCB. Western blot analysis shown are normalized byActin. The purity of the cytoplasmic fraction was confirmed by αP84 antibody. Panel B) Thedensity of the specific band was scanned and quantified with an imaging analyzer. Results indicatethe fold of increase compared with unstimulated cells in cytoplasmic and nuclear fraction of onerepresentative of three reproducible experiments.

101

Chapter 5

DISCUSSION

For a long time bilirubin was considered to be simply a waste end product of heme

metabolism. More recently strong evidence has emerged pointing to bilirubin as

an independent factor in the prevention of atherosclerotic disease (Djouss et al.,

2001). In particular, mildly elevated serum bilirubin levels were associated with a

lower incidence of ischemic cardiovascular effects (Vitek et al., 2002) raising the

idea that bilirubin can interfere with the mechanisms involved in the development

of atherosclerosis. Based on the antioxidant properties of bilirubin, the hypothesis

was formulated that bilirubin can act as a ROS scavenger was formulated (Stocker

& Keaney, 2004; Baranano et al., 2002).

More recently bilirubin was demonstrated to inhibit the proliferation of vas-

cular smooth muscle cells (Ollinger et al., 2005) and the endothelial migration of

monocytes (Keshavan et al., 2005). Furthermore, heme oxigenase-1, the widely

distributed enzyme that converts hemes into bilirubin, CO and Fe+2 formation, was

demonstrated to inhibit the over-expression of vascular adhesion molecules in-

duced by TNF-α (Blankenberg et al., 2003).

Based on previous data, we postulated that bilirubin, by itself, and in particu-

larly its active free form (unbound unconjugated bilirubin) can interfere with the

expression of adhesion molecules on endothelial cells. We created an in vitro

model of endothelial dysfunction, the earliest step in atherosclerotic disease, in

which over-expression of ICAM-1, VCAM-1 and E-selectin was induced by treat-

ment of endothelial cells with TNF-α.

103

Discussion

Two endothelial cell lines were studied: immortalized H5V cells from mice

and HUVEC cells, derived from the human umbilical cord. These cells were used

to study the nitric oxide metabolism, and the gene and protein expression of three

adhesion molecules after induction by TNF-α and/or treatment with low doses of

UCB. Our experiments utilized two concentrations of unbound bilirubin (Bf) of

15 and 30 nM, in order to mimic as closely as possible the plasma Bf levels found

in humans with mild unconjugated hyperbilirubinemia (Jacobsen & Wennberg,

1974; Nelson et al., 1974). In this in vitro system, the Bf in the medium is the

equivalent of plasma Bf, since the endothelial cells are directly bathed by the fluid

in both cases. It thus differs from others studies of central nervous system cells,

since the blood brain barrier and choroid plexus intervene between the plasma and

the neurons and astrocytes.

5.1 Viability and UCB

It is well recognized that infants who died from sever hyperbilirubinemia not only

demonstrate yellow staining of the brains but also yellow coloration of tissue

and organs. Although the occurrence of central nervous system sequelae is the

most constant clinical feature, other functional abnormalities such as diarrhoea

and urine concentration defect have also been described (Ostrow, 1986).

There have been a handful on in vitro studies demonstrating cytotoxic effects

of UCB depending on the cell type. Although this difference in most of the in vitro

cells models UCB has been found to be toxic, including fibroblast (Nelson et al.,

1974; Chuniaud et al., 1996; Ngai et al., 2000), astrocytes (Chuniaud et al., 1996),

oligodendrocytes (Genc et al., 2003), hepatocytes, erythrocytes, leukocytes, liver

(Czernobilsky & Dubin, 1965), HeLa cells (Shimabuku & Nakamura, 1983; Ngai

et al., 2000), platelets (Amit et al., 1992), neuroblastoma (Schiff et al., 1985), hep-

atoma (Thaler, 1971; Seubert et al., 2002), glioblastoma, Chang Liver (Ngai et al.,

2000) and fibrosarcoma (Cowger, 1971). Even thought there is scant information

regarding the molecular mechanism underlying these effects; it has been recently

104


demonstrated that Bf and not the total UCB elicits the toxic effect (Calligaris et al.,

2007).

The results obtained in H5V cells clearly demonstrated a reduction on the cell

viability. Interestingly, HUVEC cells seams to be more sensitive to UCB than

H5V, at same levels of Bf and at shorter incubation times (Figure 4.1). On the

other hand, as it was shown UCB did not cause membrane permeability, leading

to the release of LDH (Table 4.1), this effect may reflect the absence of necrosis at

the Bf studied. Cellular release of LDH is generally considered to be a hallmark

of necrotic cell death (O’Brien et al., 2000).

The fact that mitochondrial activity was impaired when no lysis was detectable

is in line with the hypothesis proposed by Mustapha et al. (Mustafa et al., 1969)

where mitochondrial may be the primary target for Bf. In line with this observa-

tion was the demonstration that, in astrocytes and fibroblast, the Bf level is respon-

sible of toxic effects, mainly correlated with alteration on mitochondrial activity

instead of cell lysis. Indeed, it was proposed that the aggregation of higher levels

of Bf molecules inside the cell may result in the breaking of the membrane archi-

tecture and cytolisis (Chuniaud et al., 1996).

Indeed, toxicity of higher doses of UCB (86 µM, at a UCB/albumin ratio of

3:1) in immature cells neurons is typically characterized by a perturbation of the

mitochondrial membrane, with alteration of polarity, fluidity and increasing the

permeability, leading to the release of cytochrome c (Rodrigues et al., 2002b; Ro-

drigues et al., 2002a), critical events associated with the initiation of the cell death

by apoptotic pathways.

Another study of the mitochondrial functionality clearly demonstrated that

bilirubin at high non physiological doses (25–50 µM) stimulates apoptosis of

colon adenocarcinoma cells in vitro through activation of the mitochondrial path-

way, by directly dissipating mitochondrial membrane potential. As this effect is

triggered at concentrations normally present in the intestinal lumen, it was postu-

lated a physiologic role for bilirubin in modulating colon tumorigenesis (Keshavan

105

Discussion

et al., 2004).

Furthermore, it was demonstrated that bovine brain microvascular endothelial

cells may undergo apoptosis after exposure to higher doses of bilirubin (10-100

µM). These effect appeared to be time-dependent but not clearly concentration-

dependent. Indeed, biochemical markers for apoptosis such as DNA fragmenta-

tion and PARP cleavage were induced by bilirubin (Akin et al., 2002).

It was recently reported that a given Bf concentration may or may not cause

cell lysis, depending on the ratio UCB/albumin (Calligaris et al., 2007). Further-

more, different results have been obtained depending on the cell type and the as-

says used but as mentioned previously the level of Bf used. Amplification of UCB

cytotoxicity by TNF-α and LPS was observed in fibroblast cells at a UCB/HSA

molar ratio of 1.0 (Ngai & Yeung, 1999).

It is well known that TNF-α exhibits its cytotoxic effect through binding to the

cell receptor (Fiers, 1991). The present results confirm that TNF-α was able to in-

duce cytotoxicity (Figure 4.1). Interestingly, cytotoxicity effect was more evident

on HUVEC cells. I agreement with previously studies this HUVEC seems to be

more sensitive to the absence of serum and the treatments with TNF-α or others

growth factors (Emmanuel et al., 2002). However, no further combinatory effects

were seen in co-treatment with different physiological doses of UCB in both cell

model studied. Moreover, the lack of further cytotoxic effects in co-treatments

UCB and TNF-α seems to reenforce the hypothesis of antioxidant properties of

UCB.

On the other hand, Harlan et al. (Harlan et al., 1983) reported that LPS in

concentration up to 10 µg/mL did not induce detectable cytotoxicity in human en-

dothelial cells derived from umbilical vein, pulmonary artery, or pulmonary vein.

In contrast, significant cytotoxicity was observed in bovine aortic endothelial cells

exposed to LPS as low as 0.01 µg/mL. Indeed, these data demonstrated an impor-

tant direct LPS-mediated cytotoxic effect, and that this toxic effect depends on the

species from which the endothelial cells are derived.

106


Baranano et al. (Baranano et al., 2002) introduced the hypothesis of UCB

actin as antioxidant compound like others known antioxidants such as glutathione

and α-tocopherol. It was demonstrated that the potent physiologic antioxidant ac-

tions of bilirubin reflects an amplification cycle whereby bilirubin, acting as an

antioxidant, is itself oxidized to biliverdin and then recycled by biliverdin reduc-

tase back to bilirubin. This redox cycle may constitute the principal physiologic

function of bilirubin. However, most of the previous studies that evaluated an-

tioxidant actions of bilirubin, were restricted to in vitro experiments measuring

the antioxidant potential of bilirubin, or examined protection conferred by exoge-

nous bilirubin. In line with this idea, the cytoprotective UCB effects have been

then confirmed in vivo and in vitro by inhibiting ROS. UCB and α-tocopherol pro-

tected oligondendrocytes from H2O2 (100 µM). Interestingly, bilirubin seems to

be more effective than α-tocopherol at the same concentration (50 nM). However,

the cytoprotection of bilirubin diminished at higher concentration (100 µM) pre-

sumably because higher levels of UCB are themselves cytotoxic (Liu et al., 2003).

Another study conducted in erythrocytes derived from cord blood demon-

strated antioxidant properties of bilirubin. It was concluded that bilirubin, at phys-

iologic concentrations, protects neonatal red blood cells against oxidative stress.

However, bilirubin at concentrations equal or exceeding 30 mg/dL and a biliru-

bin/BSA ratio of greater than one, was associated with significant cytotoxicity.

Additionally, cytotoxicity was evaluated by increased protein oxidation, decreased

erythrocyte glucose-6 phosphate dehydrogenase and adenosine triphosphatase ac-

tivity, and altered cell membrane integrity (Mireles et al., 1999).

Moreover, bilirubin physiologic role relates to cytoprotection generated en-

dogenous by Heme oxygenase-1, the rate limiting enzyme of heme degradation,

was confirmed in several studies directly related to inflammatory stress and en-

dothelial dysfunction that will discuss latter (Kawamura et al., 2005; Taille et al.,

2003).

Although it is believed that the action of UCB is basically related to its toxic

107

Discussion

and antioxidant effects in respect of its concentration (Ostrow & Tiribelli, 2003),

the aim of the present data is to demonstrate that UCB may have some other cellu-

lar functions. Moreover, the previous findings outline the idea that may be difficult

to formulate a unifying concept of UCB effects. This conclusion is supported by

several reports in neural cells that demonstrated different sensitivities to bilirubin

cytotoxicity (Schiff et al., 1985; Notter & Kendig, 1986; Calligaris et al., 2007).

The contradictory observations in the cellular response in several studies may be

the result of non-physiologic concentration of bilirubin used or in alternative, the

presence of different mechanism of action in different cell lines (Calligaris et al.,

2007).

5.2 Nitric oxide and UCB

Accumulating evidence suggested that increased vascular oxidant stress represent

a major cause of reduced endothelial NO bio-availability in experimental and clin-

ical cardiovascular disease. Different mechanism may explain why changes of the

endothelial redox state have a profound impact on endothelial NO availability

(Boulden et al., 2006):

• a direct inactivation of NO by superoxide O–2 ;

• a reduced NOS activity, by increasing endogenous inhibitors;

• an increased oxidation of critical cofactors, such as BH4 by changes of the

endothelial redox state .

All these mechanisms may contribute to explain the NO levels in endothelial

cells which are important for endothelium dependent vasodilation, suppression of

thrombosis, vascular inflammation and thrombosis. This concept has been sup-

ported by several clinical studies, where endothelium dependent vasomotion is

therefore to represent a surrogate marker for cardiovascular events (Landmesser

et al., 2006).

The current study provides several evidence about NO regulation in two mod-

els of endothelial cells (H5V and HUVEC). The regulation of NO metabolism and

108


the enzymes involved the synthesis (eNOS and iNOS) during the pro-inflammatory

state seems to be controversial (Wever et al., 1998). Cytokines are believed to in-

duce the production of substantial amounts of NO by increasing iNOS expression

and activity during the pro-inflammatory state (Nathan, 1992). However, eNOS

down-regulation by TNF-α, and the decreased bio-availability of NO on the devel-

opment of the endothelial dysfunction was also reported (Lai et al., 2003; Govers

& Rabelink, 2001).

Our data demonstrated a redaction of NO levels by treatments with the pro-

inflammatory cytokine TNF-α in time (Table 4.3) and in dose-dependent manner

(Table 4.2). Moreover, the increase of the NO content in control conditions seems

to be time dependent (Table 4.3). Even though these results were further con-

firmed by using an ion chromatography with suppressed conductivity detection,

the interferences of the Griess’ method can not be exclude (Nithipatikom et al.,

1996). However, it was demonstrated in rabbit corneal cells that a mixture of

cytokines, TNF-α, IL-1β and INF-γ are required to induce significant nitrite ac-

cumulation and iNOS expression. Indeed in absence of INF-γ, little or no nitrite

accumulation by TNF-α was reported (O’Brien et al., 2001).

It is well known that the activity of NO is not restricted to the site of produc-

tion. As un-charged gas, NO radicals are highly diffusible. Indeed, the generation

of s-nitrosothiols, s-nitrosylated proteins, and s-nitrosyl-metal complex can medi-

ate its functions for instances to long distances. Moreover, the imbalance of pro-

and anti-apoptotic effects can thus be best understood in terms of the specific cys-

containing proteins that are targets of NO in the context of cell type and stimulus

(Gaston et al., 2006).

On the other hand, during the endothelial dysfunction state a reduction of

NO levels were reported and explained by different mechanism, increasing of

ROS production, among others. ECs have been shown to generate significant

amounts of ROS (Stroes et al., 1998) and to express enzymes (e.g. eNOS, NADPH

oxidase, CYP, COX) that can produce ROS in response to receptor activation

or other cellular events that elevate intracellular calcium. NO is the principal

109

Discussion

endothelium-derived dilator operating in the vasculature and its activity can be

governed by the amount of ROS in the vascular milieu, whereby superoxide anions

can rapidly scavenge NO at a diffusion-controlled rate (Endemann & Schiffrin,

2004; Madamanchi et al., 2005). NO displays high affinity for heme groups and

many enzymes, including those noted above (NOS, COX, CYP etc) have heme

groups. Thus NO itself may inhibit the enzymatic production of superoxide and

H2O2 (Griscavage et al., 1994). The relative contributions of NO and ROS to

vascular tone are inversely proportional to each other and the appearance of one

could likely compensate for the absence of the other.

Pathophysiological conditions such as diabetes and atherosclerosis display

signs of oxidative stress and dysfunctions in the NO pathway, thus it may be valid

to argue that endothelial ROS production could be compensating for impairments

to normal relaxant mechanisms (Wever et al., 1998). If this hypothesis is cor-

rect then there should be an increased contribution of H2O2 in pathophysiological

states where the normal production of NO is compromised.

Boulden et al. (Boulden et al., 2006) demonstrated that endothelial dysfunc-

tion can be induced by H2O2 and may be mediated by the NADPH oxidase and

its product, O–2 . The activation of the NADPH oxidase results in increased O–

2

with effects on NO production. This implies that ROS may be a downstream ef-

fector of NADPH oxidase activation in order to decreased NO levels and mediate

endothelial dysfunction.

Furthermore, increased NADPH oxidase activity is associated with hyperten-

sion and progression of atherosclerosis, suggesting that this enzyme may be part

of the pathogenic cascade leading to uncompensated oxidative stress (Cai et al.,

2003).

In agreement with these findings, several reviews indicated the role of TNF-α

in ROS production. TNF-α induces oxidative stress by activating the NADPH

oxidase complex, the major source of endothelial reactive oxygen species produc-

tion (Li et al., 2002).

110


Jiang et al. (Jiang et al., 2006) demonstrated in human microvascular en-

dothelial cells that NO donors strongly induce expression of heme oxygenase-1.

This was associated with a reduction of the superoxide-generating capacity of

NADPH oxidase, an effect that depends on de novo gene transcription and heme

oxygenase-1 activity. Activation of NADPH oxidase by TNF-α increased genera-

tion of reactive oxygen species, specially when heme oxygenase-1 expression was

blocked with specific small-interfering RNA. Interestingly, these results demon-

strated that bilirubin (1-100 nM) suppressed TNF-α induced ROS formation by

inhibiting NADPH oxidase activity.

Moreover, it was reported in fibroblast that high UCB levels inhibit protein

kinase C phosphorylation. Then UCB may regulate the activation of NADPH ox-

idase by changing the phosphorylation state, crucial for NADPH oxidase activity,

of the p47 phox subunit (Amit & Boneh, 1993).

In the present study, TNF-α was able to induce iNOS expression in a time

dependent manner without modifying eNOS mRNA (Figure 4.3), in line with pre-

views reports (Bruch-Gerharz et al., 1998). However, a discrepancy between the

induction of iNOS expression and the NO levels was observed. Probably, a re-

duction of NO levels or a generation of other forms of nitrosative reactive species

generated by ROS can occurred. The ROS hypothesis was then verified by us-

ing NAC, a well known antioxidant. The present data demonstrate that NO basal

levels were reduced by treatment with NAC alone (Figure 4.6). These data may

partially demonstrate the hypothesis of ROS generation in H5V cell model. More-

over when NAC and TNF-α where added together, a further reduction on NO

levels was observed. This reduction may be the result of the reduction of ROS

generated by NAC as antioxidant but also by a reduction on iNOS expression, as

shown in Figure 4.5 and Figure 4.6. Interestingly, co-treatment with TNF-α and

NAC was able to inhibit NO production. Furthermore, as shown in Figure 4.6,

iNOS expression induced by TNF-α was blunted by treatment with NAC. These

results clearly demonstrated a complex and multi-step regulatory mechanism in

the synthesis of NO, iNOS expression, and consumption, ROS.

111

Discussion

The present data also clearly demonstrate a role of UCB on the modulation of

NO metabolism. However, the molecular events on NO levels by UCB may be

difficult to explain for several reasons. First, NO levels are the result of a very

complex regulation and UCB may be involved in different steps. At 48 hours NO

levels were reversed by UCB even at upper-normal physiological (15 nM) and

mildly elevated (30 nM) Bf (Figure 4.2). These results may be explained by an

up-regulation of iNOS induced by UCB at 24 hours (Figure 4.4). However, af-

ter 2 hours of treatment UCB significantly inhibits iNOS expression (Figure 4.4).

Interestingly, at 2 hours NO levels were not detectable. This complex biphasic

regulation of UCB on iNOS expression may be explained by a modulation the

NO levels. It was reported that NO levels are responsible of iNOS regulation it-

self (Schwartz et al., 1997). In this case as NO levels were not detectable, UCB

may prevent NO induction. On the other hand, when NO levels were dismissed

(at 48 hours), UCB may compensate these effects by a synergistic effect on iNOS

TNF-α induction (24 hours). However, further results need to be obtained in order

to prove these hypothesis. The additive effect observed between UCB and NAC

reinforced the hypothesis of the redox state (Figure 4.7).

It was demonstrated both in vivo and in vitro, that UCB limits the increase

hepatic levels of TNF-α, nitric oxide (NO) and iNOS caused by treatment with

endotoxin (Wang et al., 2004). These results, in agreement with our data, suggests

a role for bilirubin in the prevention of the tissue injury in response to inflamma-

tory stimuli.

NO levels in freshly isolatedHUVEC cells were undetectable, in line with sev-

eral in vitro studies. However, HUVEC cells freshly isolated and treated with

TNF-α seems to increase NO production together with an increase in the iNOS

expression (Orpana et al., 1997). Conversely, iNOS induction could not be further

detected in HUVEC subcultures passed once from cells presenting maximal levels

of iNOS expression in the primary culture (de Assis et al., 2002). No changes in

eNOS expression were seen in the present study by treatment with TNF-α at all

times studied (Table 4.4). Moreover, iNOS mRNA expression was undetectable.

112

5.3 Adhesion molecules and UCB

While accumulating evidence on different sources of endothelial cells dem-

onstrated ROS effects, the TNF-α effects on NO metabolism are still not fully

elucidated (Govers & Rabelink, 2001; Yang & Rizzo, 2007). However our data,

accordingly with recent studies on heme oxygenase-1 (Jiang et al., 2006), pointed

out UCB as a potential modulator of of the oxidant stress and the cardiovascular

protective actions.

5.3 Adhesion molecules and UCB

Our results demonstrated, for the first time, that in both the mouse and human

endothelial cell lines UCB, at Bf that did not affect the expression of the three ad-

hesion molecules, blunts the over-expression of E-selectin and VCAM-1 induced

by a pro-inflammatory cytokine such as TNF-α, indicating the lack of species

specific effect (Figure 4.9, 4.12, 4.10, 4.13). By contrast, the enhanced gene ex-

pression of ICAM-1 induced by TNF-α was blunted by UCB only in the human

(HUVEC) cell line (Figure 4.11, 4.14). In both cell lines the inhibitory effect of

UCB was usually modest (20-30%), detected and 2 and/or 6 hours, but vanished

by 24 hours.

E-selectin, ICAM-1 and VCAM-1 are known to share many common regula-

tory mechanisms but only partially shared in the NF-κB pathway (Marui et al.,

1993; Zerfaoui et al., 2008). Thus, in endothelial cells the treatment with heme-

oxygenase, a precursor of bilirubin formation, inhibited only the TNF-α induced

over-expression of VCAM-1 and E-selectin but not ICAM-1, indicating that dif-

ferent regulatory mechanism are involved (Soares et al., 2004).

Interestingly, in both cell models E-selectin was the adhesion molecule whose

gene expression was the earliest to be influenced by UCB. The variations were

observed just 2 hours after exposure to the pigment. This data is consistent with

the well established observation that E-selectin is the first adhesion molecule to

be involved, in a time dependent manner, in the leukocyte recruitment by rolling

113

Discussion

and tethering (Blankenberg et al., 2003).

On the other hand, in H5V cells, UCB blunted the protein over-expression of

all three adhesion molecules induced by TNF-α (Figure 4.18). These findings

suggests a post-transcriptional influence of bilirubin, yet to be demonstrated.

A recent study, in murine endothelial cells, demonstrated a different pattern of

expression of the three adhesion molecules studied in acute and chronic treatment

with TNF-α. E-selectin was strongly up regulated in acute but not in chronic in-

flammation. More over VCAM-1 reveled a similar patter in contrast with ICAM-1

(Rajashekhar et al., 2007). The authors proposed that the discrepancies found in

several studies can be explained as: 1) tissue culture conditions and immortaliza-

tion procedures further contributing to the differences in response to TNF-α; 2)

mouse endothelial cells used respond differently from human endothelial cells. In

agrement with this hypothesis the presents results demonstrated that UCB effects,

at leat for the adhesion molecules expression, appears to be lack of species spe-

cific effect. Previous studies pointed out the potential role of UCB in modulating

the trans-endothelial migration Vcam-1 mediated in vivo (Keshavan et al., 2005).

Even though the culture conditions differ among the studies, specially for UCB

concentrations, these findings support a potential role for bilirubin as an endoge-

nous immunomodulatory agent. However the molecular mechanisms underlying

this activation, or blunt in terms of UCB effect, are not fully understood, nor is it

known whether these genes are activated by common, or gene-specific, regulatory

factors.

5.4 Signalling pathways and UCB

The present data may rise the hypothesis that bilirubin can influence the inflam-

matory markers (NO and adhesion molecules) by interfering with the pathways

involved in the regulation endothelial dysfunction. However, the exact mecha-

nism(s) responsible for bilirubin-mediated antioxidant o toxicity remains largely

114


unknown. An interesting question is: how bilirubin could mediate its effects?.

Several data demonstrated the UCB effects are limited to binding to nuclear recep-

tors. It was shown that bilirubin might have a direct regulatory effect by binding

the aryl hydrocarbon receptor (Seubert et al., 2002) or indirectly by activation of

constitutive androstane receptor (Huang et al., 2004). Both receptors are associ-

ated with multiple cellular functions, cell cycle (Elizondo et al., 2000), apoptotic

response (Reiners & Clift, 1999), xenobiotics hepatic clearance (Wei et al., 2000),

indicating its interactions with signalling pathways.

Several signalling pathways are described to be involved in regulating the gene

expression of iNOS and adhesion molecules specially NF-κB (Baeuerle, 1998a;

Ghosh et al., 1998; Hanada & Yoshimura, 2002; Lin et al., 2007) and CREB (Ger-

ritsen et al., 1997; Ono et al., 2006; Ciani et al., 2002).

In the present study it was demonstrated that PDTC, an IκB inhibitor that pre-

vents the release of p65 (Schoonbroodt & Piette, 2000), has an additive inhibitory

effect on TNF-α induction of iNOS and the adhesion molecules indicating that

bilirubin may also act through an other signalling cascade (Figure 4.20).

When the extent of NF-κB nuclear translocation was evaluated after TNF-α

and UCB co-treatment in our H5V cells, the TNF-α-stimulated nuclear translo-

cation was inhibited by UCB (Figure 4.23). This result confirmed that UCB can

affect the NF-κB regulatory pathway, probably through an interaction with the

IKK proteins (Malek et al., 2001).

CREB is also involved in the up-regulation of Vcam-1 and E-selectin gene

expression induced by TNF-α (Gerritsen et al., 1997; Ono et al., 2006). It was

investigated the CREB cascade to look for a possible involvement of UCB on

this signalling cascade. However, no influence of UCB on the phosphorylation of

CREB (Figure 4.22) induced by TNF-α was observed (Figure 4.21). Thus CREB

does not mediate the influences of UCB on the expression of the adhesion mole-

cules in H5V cells.

115

Discussion

Bilirubin is already known to be a modulator of the NF-κB signal transduc-

tion pathway in astrocytes. Furthermore it was demonstrated that high doses of

UCB (50 µM) induces p65 NF-κB subunit nuclear translocation after 4 hours of

treatment (Fernandes et al., 2006). On the other hand, it was recently reported that

biliverdin inhibits the transcriptional activity of NF-κB in HEK293A cells, by in-

hibiting TNF-α-induced DNA binding (Gibbs & Maines, 2007). The coimmuno-

precipitation data showed that biliverdin reductase binds, under TNF-α stimulus,

to the p65 subunit of NF-κB. Indeed, an over-expression of biliverdin reductase

enhanced both the basal and TNF-α-mediated activation of NF-κB and the con-

comitant iNOS gene activation (Gibbs & Maines, 2007). These results do not fit

with the findings of the present study. These differences may be a further demon-

stration of the dual bilirubin effect, toxic at high concentration and protective at

low levels, modulating at least in part by NF-κB signalling pathway.

It is becoming clear that NO itself plays a pivotal role in the regulation of the

gene expression, specially by this regulatory activity may control iNOS gene in-

duction.(Schwartz et al., 1997). Such mechanism would constitute a self-regulating

pathway by which NO production from this NOS could be fine-tuned (Schwartz

et al., 1997; Bogdan, 2001a). This biphasic activity of NO appears to play a cen-

tral role in the time course of activation of these immune cells and, by inference,

in facilitating the initiation of a defense response against pathogenic stimuli and

in its termination to limit tissue damage. This mechanism, mainly due to the NF-

κB pathway, can also explain at least in part the reported ability of NO to act in

both a pro- and anti-inflammatory manner (Connelly et al., 2001). Interestingly,

the results described in the present data demonstrated that UCB may also have a

biphasic effects on iNOS regulation (Figure 4.4). Low concentrations of NO (such

as occur after 2 hours of treatment with TNF-α) activate NF-κB and up-regulated

iNOS while high concentrations of NO have the opposite effect. UCB may help

to regulate NO production preventing its overproduction and avoiding its reduc-

tion. As it was demonstrated previously UCB effects on iNOS expression may be

mediated, at least in part, by preventing the NF-κB nuclear translocation induced

by TNF-α (Figures 4.20 and 4.23). However, on the modulation of NO levels

by UCB the contribution of others pathways or post-transcriptional mechanisms

116


affecting NOS activity can not be excluded.

Other studies suggested that UCB would be able to modulate others signal

transduction pathways. In HeLa and mouse embryonic fibroblast, UCB at high

toxic concentrations (80 nM) induced oxidative stress, activated APE1/Ref-1, a

master redox signalling pathway regulator in eukaryotic cells and induced the ac-

tivation of Egr-1 transcription factor by up regulation of PTEN tumor suppressor

(Cesaratto et al., 2007). In this way UCB may induce cell toxicity not only by

modulating NF-κB (Fernandes et al., 2006).

Adhesion molecules such as VCAM-1, E-selectin and ICAM-1 are highly reg-

ulates at transcriptional level by a large number of mediators. As it was mentioned

previously, NF-κB is believed to play a critical role in mediating inflammatory re-

sponse in endothelium (Martin et al., 2000). However, the used of different doses

of PDTC, the specific inhibitor, could not complectly revert TNF-α stimulation

of iNOS and the three genes studied (Figure 4.19). These results suggest that an

overlapping distinct signalling pathways may serve to modulate pro-inflammatory

genes expression (Quinlan et al., 1999; Marui et al., 1993; Zerfaoui et al., 2008).

Several others pathways seams to be important by the modulation of the adhe-

sion molecules. Among them, the NFAT family of transcription factors regulated

by calcium and calcineurin. NFAT proteins are phosphorylated and reside in the

cytoplasm in resting cells; upon stimulation, they are dephosphorylated by cal-

cineurin, translocated to the nucleus to activate the transcription of a large number

of genes (Hogan et al., 2003). Moreover, the activation of endothelial cells by

thrombin involves an interplay between NFAT and NF-κB signaling pathways to

modulate cooperatively the VCAM-1 gene expression (Minami et al., 2006). It

was demonstrated that bilirubin is a modulator of calcium reservoirs increasing

intracellular calcium levels (Brito et al., 2004). These results according to the

present data may formulate the hypothesis that some other pathways are impor-

tant to determine UCB effects, specially those relative to its protective functions.

Altogether, our data suggest that bilirubin may blunt the pro-inflammatory

117

Discussion

state determined by the cytokine TNF-α by interacting, at least in part, with the

NF-κB transcription factor. However the contribution of other signalling path-

ways can not be excluded.

118

Chapter 6

CONCLUSIONS

The results obtained in the present study show that unconjugated bilirubin, even

at upper-normal physiological (15 nM) and mildly elevated (30 nM) Bf can mod-

ulate gene expression and endothelial cell function.

In this in vitro system UCB reduces the viability of endothelial cells in a dose

dependent manner. The cytotoxic is primary observed by a impaired mitochon-

drial function. This effect is more evident at high levels of bilirubin (100 nM).

Moreover, the accumulation inside the cell at higher Bf may induced a disrup-

tion on the cell membrane leading to necrosis and cell death. However, the lack

of combinatory further effects between UCB and the pro-inflammatory cytokine

TNF-α may reinforce the hypothesis of antioxidant properties od UCB.

This observation pointed out the important role of the Bf in order to compare

different results. Indeed, non-physiologic concentration of bilirubin used may re-

flect in different cellular responses.

The results described demonstrated in mouse endothelial cell line that UCB

(at normal and mildly elevated physiological levels) may have a biphasic effects

on iNOS regulation. This effect was described by NO itself, low concentrations

of NO (such as occur after 2 hours of treatment with TNF-α) may activate NF-κB

and up-regulated iNOS. High concentrations of NO could have the opposite ef-

fect. UCB may help to regulate NO production preventing its overproduction and

avoiding its reduction. As it was demonstrated previously, UCB effects on iNOS

119

Conclusions

expression may be mediated, at least in part, by preventing the NF-κB nuclear

translocation induced by TNF-α.

The results demonstrate also, for the first time, that in mouse and human en-

dothelial cell lines UCB, at Bf that did not themselves affect the expression of

the three adhesion molecules, blunts the over-expression of E-selectin and Vcam1

induced by a pro-inflammatory cytokine such as TNF-α, indicating the lack of

species specific effect. By contrast, the enhanced gene expression of Icam-1 in-

duced by TNF-α was blunted by UCB only in the human (HUVEC) cells line.

In both cell lines, the inhibitory effect of UCB was usually modest (20-30%) and

detected at 2 and/or 6 hours, but had worn off by 24 hours.

In summary, these data indicate that bilirubin may blunt the development of

endothelial dysfunction by modulating the adhesion molecules over-expression

and the NO metabolism in the pro-inflammatory state induced by the cytokine

TNF-α. Even though UCB alone does not alter these markers. UCB effects are

mediated in part by a modulation of the NF-κB transcription factor. These results

support the concept that modestly elevated concentrations of bilirubin may help

prevent atherosclerotic disease as suggested by epidemiological studies.

120

ACKNOWLEDGEMENTS

121

REFERENCES

Abbassi, O., Kishimoto, T., McIntire, L., Anderson, D. & Smith, C. (1993). E-selectin

supports neutrophil rolling in vitro under conditions of flow. J.Clin.Invest 92, 2719–

2730.

Abe, K., Pan, L. H., Watanabe, M., Konno, H., Kato, T. & Itoyama, Y. (1997). Upreg-

ulation of protein-tyrosine nitration in the anterior horn cells of amyotrophic lateral

sclerosis. Neurol Res 19, 124–128.

Abu-Soud, H. M. & Stuehr, D. J. (1993). Nitric oxide synthases reveal a role for calmod-

ulin in controlling electron transfer. Proc Natl Acad Sci U S A 90, 10769–10772.

Adams, J. C. & Watt, F. M. (1993). Regulation of development and differentiation by the

extracellular matrix. Development 117, 1183–1198.

Ahlfors, C. E. (1981). Effect of serum dilution on apparent unbound bilirubin concentra-

tion as measured by the peroxidase method. Clin Chem 27, 692–696.

Ahlfors, C. E. (2001). Bilirubin-albumin binding and free bilirubin. J Perinatol 21 Suppl

1, S40–2; discussion S59–62.

Akin, E., Clower, B., Tibbs, R., Tang, J. & Zhang, J. (2002). Bilirubin produces apoptosis

in cultured bovine brain endothelial cells. Brain Res 931, 168–175.

Albina, J. E., Mills, C. D., Barbul, A., Thirkill, C. E., Henry, W. L., Mastrofrancesco, B.

& Caldwell, M. D. (1988). Arginine metabolism in wounds. Am J Physiol 254,

E459–E467.

Alderton, W., Cooper, C. & Knowles, R. (2001). Nitric oxide synthases: structure, func-

tion and inhibition. Biochem.J. 357, 593–615.

123

REFERENCES

Amit, Y. & Boneh, A. (1993). Bilirubin inhibits protein kinase C activity and protein

kinase C-mediated phosphorylation of endogenous substrates in human skin fibrob-

lasts. Clin.Chim.Acta 223, 103–111.

Amit, Y., Cashore, W. & Schiff, D. (1992). Studies of bilirubin toxicity at the synaptosome

and cellular levels. Semin Perinatol 16, 186–190.

Aoki, N., Siegfried, M. & Lefer, A. M. (1989). Anti-EDRF effect of tumor necrosis factor

in isolated, perfused cat carotid arteries. Am J Physiol 256, H1509–H1512.

Aplin, A., Hogan, B., Tomeu, J. & Juliano, R. (2002). Cell adhesion differentially reg-

ulates the nucleocytoplasmic distribution of active MAP kinases. J.Cell Sci. 115,

2781–2790.

Arenzana-Seisdedos, F., Turpin, P., Rodriguez, M., Thomas, D., Hay, R. T., Virelizier,

J. L. & Dargemont, C. (1997). Nuclear localization of I kappa B alpha promotes

active transport of NF- kappa B from the nucleus to the cytoplasm. J Cell Sci 110 (

Pt 3), 369–378.

Arias, J., Alberts, A. S., Brindle, P., Claret, F. X., Smeal, T., Karin, M., Feramisco, J. &

Montminy, M. (1994). Activation of cAMP and mitogen responsive genes relies on

a common nuclear factor. Nature 370, 226–229.

Assreuy, J., Cunha, F. Q., Liew, F. Y. & Moncada, S. (1993). Feedback inhibition of nitric

oxide synthase activity by nitric oxide. Br J Pharmacol 108, 833–837.

Baeuerle, P. (1998a). Pro-inflammatory signaling: last pieces in the NF- kappa B puzzle?

Curr.Biol. 8, R19–R22.

Baeuerle, P. (1998b). I kappa B-NF- kappa B structures: at the interface of inflammation

control. Cell 95, 729–731.

Balligand, J. L., Kobzik, L., Han, X., Kaye, D. M., Belhassen, L., O’Hara, D. S., Kelly,

R. A., Smith, T. W. & Michel, T. (1995). Nitric oxide-dependent parasympathetic

signaling is due to activation of constitutive endothelial (type III) nitric oxide syn-

thase in cardiac myocytes. J Biol Chem 270, 14582–14586.

Baranano, D., Rao, M., Ferris, C. & Snyder, S. (2002). Biliverdin reductase: a major

physiologic cytoprotectant. Proc.Natl.Acad.Sci.U.S.A 99, 16093–16098.

124

REFERENCES

Barath, P., Fishbein, M., Cao, J., Berenson, J., Helfant, R. & Forrester, J. (1990). Tu-

mor necrosis factor gene expression in human vascular intimal smooth muscle cells

detected by in situ hybridization. Am.J.Pathol. 137, 503–509.

Barroga, C. F., Stevenson, J. K., Schwarz, E. M. & Verma, I. M. (1995). Constitutive

phosphorylation of IkappaBalpha by casein kinase II. Proc Natl Acad Sci U S A 92,

7637–7641.

Beck, K. F. & Sterzel, R. B. (1996). Cloning and sequencing of the proximal promoter of

the rat iNOS gene: activation of NF kappa B is not sufficient for transcription of the

iNOS gene in rat mesangial cells. FEBS Lett 394, 263–267.

Bevilacqua, M., Pober, J., Mendrick, D., Cotran, R. & Gimbrone, M.A., J.

(1987). Identification of an inducible endothelial-leukocyte adhesion molecule.

Proc.Natl.Acad.Sci.U.S.A 84, 9238–9242.

Bevilacqua, M. P. & Nelson, R. M. (1993). Selectins. J Clin Invest 91, 379–387.

Blankenberg, S., Barbaux, S. & Tiret, L. (2003). Adhesion molecules and atherosclerosis.

Atherosclerosis 170, 191–203.

Bobryshev, Y. (2006). Monocyte recruitment and foam cell formation in atherosclerosis.

Micron. 37, 208–222.

Bogdan, C. (2001a). Nitric oxide and the immune response. Nat.Immunol. 2, 907–916.

Bogdan, C. (2001b). Nitric oxide and the regulation of gene expression. Trends Cell Biol

11, 66–75.

Booyse, F., Quarfoot, A., Chediak, J., Stemerman, M. & Maciag, T. (1981). Characteri-

zation and properties of cultured human von Willebrand umbilical vein endothelial

cells. Blood 58, 788–796.

Bosma, P. J. (2003). Inherited disorders of bilirubin metabolism. J Hepatol 38, 107–117.

Bosma, P. J., Seppen, J., Goldhoorn, B., Bakker, C., Elferink, R. P. O., Chowdhury, J. R.,

Chowdhury, N. R. & Jansen, P. L. (1994). Bilirubin UDP-glucuronosyltransferase

1 is the only relevant bilirubin glucuronidating isoform in man. J Biol Chem 269,

17960–17964.

125

REFERENCES

Boulden, B. M., Widder, J. D., Allen, J. C., Smith, D. A., Al-Baldawi, R. N., Harrison,

D. G., Dikalov, S. I., Jo, H. & Dudley, S. C. (2006). Early determinants of H2O2-

induced endothelial dysfunction. Free Radic Biol Med 41, 810–817.

Bowie, A. & O’Neill, L. A. (2000a). Oxidative stress and nuclear factor- kappa B acti-

vation: a reassessment of the evidence in the light of recent discoveries. Biochem

Pharmacol 59, 13–23.

Bowie, A. G. & O’Neill, L. A. (2000b). Vitamin C inhibits NF- kappa B activation by

TNF via the activation of p38 mitogen-activated protein kinase. J Immunol 165,

7180–7188.

Bredt, D. S., Glatt, C. E., Hwang, P. M., Fotuhi, M., Dawson, T. M. & Snyder, S. H.

(1991). Nitric oxide synthase protein and mRNA are discretely localized in neuronal

populations of the mammalian CNS together with NADPH diaphorase. Neuron 7,

615–624.

Breimer, L., Wannamethee, G., Ebrahim, S. & Shaper, A. (1995). Serum bilirubin and risk

of ischemic heart disease in middle-aged British men. Clin.Chem. 41, 1504–1508.

Breimer, L. H., Spyropolous, K. A., Winder, A. F., Mikhailidis, D. P. & Hamilton, G.

(1994). Is bilirubin protective against coronary artery disease? Clin Chem 40,

1987–1988.

Brindle, P., Linke, S. & Montminy, M. (1993). Protein-kinase-A-dependent activator in

transcription factor CREB reveals new role for CREM repressors. Nature 364, 821–

824.

Brito, M. A., Brites, D. & Butterfield, D. A. (2004). A link between hyperbilirubinemia,

oxidative stress and injury to neocortical synaptosomes. Brain Res 1026, 33–43.

Bruch-Gerharz, D., Ruzicka, T. & Kolb-Bachofen, V. (1998). Nitric oxide in human skin:

current status and future prospects. J.Invest Dermatol. 110, 1–7.

Cai, H. & Harrison, D. (2000). Endothelial dysfunction in cardiovascular diseases: the

role of oxidant stress. Circ.Res. 87, 840–844.

Cai, H., Li, Z., Davis, M. E., Kanner, W., Harrison, D. G. & Dudley, S. C. (2003). Akt-

dependent phosphorylation of serine 1179 and mitogen-activated protein kinase ki-

nase/extracellular signal-regulated kinase 1/2 cooperatively mediate activation of the

126

REFERENCES

endothelial nitric-oxide synthase by hydrogen peroxide. Mol Pharmacol 63, 325–

331.

Calligaris, S. D., Bellarosa, C., Giraudi, P., Wennberg, R. P., Ostrow, J. D. & Tiribelli, C.

(2007). Cytotoxicity is predicted by unbound and not total bilirubin concentration.

Pediatr Res 62, 576–580.

Carswell, E., Old, L., Kassel, R., Green, S., Fiore, N. & Williamson, B.

(1975). An endotoxin-induced serum factor that causes necrosis of tumors.


Casasnovas, J., Pieroni, C. & Springer, T. (1999). Lymphocyte function-associated

antigen-1 binding residues in intercellular adhesion molecule-2 (ICAM-2) and the

integrin binding surface in the ICAM subfamily. Proc.Natl.Acad.Sci.U.S.A 96,

3017–3022.

Castelli, W. P., Garrison, R. J., Wilson, P. W., Abbott, R. D., Kalousdian, S. & Kannel,

W. B. (1986). Incidence of coronary heart disease and lipoprotein cholesterol levels.

The Framingham Study. JAMA 256, 2835–2838.

Caterina, R. D., Libby, P., Peng, H. B., Thannickal, V. J., Rajavashisth, T. B., Gimbrone,

M. A., Shin, W. S. & Liao, J. K. (1995). Nitric oxide decreases cytokine-induced

endothelial activation. Nitric oxide selectively reduces endothelial expression of ad-

hesion molecules and proinflammatory cytokines. J Clin Invest 96, 60–68.

Cesaratto, L., Calligaris, S. D., Vascotto, C., Deganuto, M., Bellarosa, C., Quadrifoglio,

F., Ostrow, J. D., Tiribelli, C. & Tell, G. (2007). Bilirubin-induced cell toxicity

involves PTEN activation through an APE1/Ref-1-dependent pathway. J Mol Med

85, 1099–1112.

Cheng, J. D., Ryseck, R. P., Attar, R. M., Dambach, D. & Bravo, R. (1998). Functional

redundancy of the nuclear factor kappa B inhibitors I kappa B alpha and I kappa B

beta . J Exp Med 188, 1055–1062.

Cho, H. J., Xie, Q. W., Calaycay, J., Mumford, R. A., Swiderek, K. M., Lee, T. D.

& Nathan, C. (1992). Calmodulin is a subunit of nitric oxide synthase from

macrophages. J Exp Med 176, 599–604.

127

REFERENCES

Chu, S. C., Marks-Konczalik, J., Wu, H. P., Banks, T. C. & Moss, J. (1998). Analysis of

the cytokine-stimulated human inducible nitric oxide synthase (iNOS) gene: char-

acterization of differences between human and mouse iNOS promoters. Biochem

Biophys Res Commun 248, 871–878.

Chuniaud, L., Dessante, M., Chantoux, F., Blondeau, J., Francon, J. & Trivin, F. (1996).

Cytotoxicity of bilirubin for human fibroblasts and rat astrocytes in culture. Effect

of the ratio of bilirubin to serum albumin. Clin.Chim.Acta 256, 103–114.

Ciani, E., Guidi, S., Della, V. G., Perini, G., Bartesaghi, R. & Contestabile, A. (2002). Ni-

tric oxide protects neuroblastoma cells from apoptosis induced by serum deprivation

through cAMP-response element-binding protein (CREB) activation. J.Biol.Chem.

277, 49896–49902.

Cieslik, K., Zembowicz, A., Tang, J. L. & Wu, K. K. (1998). Transcriptional regulation

of endothelial nitric-oxide synthase by lysophosphatidylcholine. J Biol Chem 273,

14885–14890.

Cines, D. B., Pollak, E. S., Buck, C. A., Loscalzo, J., Zimmerman, G. A., McEver, R. P.,

Pober, J. S., Wick, T. M., Konkle, B. A., Schwartz, B. S., Barnathan, E. S., McCrae,

K. R., Hug, B. A., Schmidt, A. M. & Stern, D. M. (1998). Endothelial cells in

physiology and in the pathophysiology of vascular disorders. Blood 91, 3527–3561.

Clark, J. E., Foresti, R., Sarathchandra, P., Kaur, H., Green, C. J. & Motterlini, R. (2000).

Heme oxygenase-1-derived bilirubin ameliorates postischemic myocardial dysfunc-

tion. Am J Physiol Heart Circ Physiol 278, H643–H651.

Clermont, F., Adam, E., Dumont, J. & Robaye, B. (2003). Survival pathways regulating

the apoptosis induced by tumour necrosis factor- alpha in primary cultured bovine

endothelial cells. Cell Signal. 15, 539–546.

Connelly, L., Palacios-Callender, M., Ameixa, C., Moncada, S. & Hobbs, A. (2001).

Biphasic regulation of NF- kappa B activity underlies the pro- and anti-inflammatory

actions of nitric oxide. J.Immunol. 166, 3873–3881.

Constantinescu, A., Gordon, A. & Diamond, I. (2002). cAMP-dependent protein kinase

types I and II differentially regulate cAMP response element-mediated gene expres-

sion: implications for neuronal responses to ethanol. J.Biol.Chem. 277, 18810–

18816.

128

REFERENCES

Cook, J., Kim, S., Teague, D., Krishna, M., Pacelli, R., Mitchell, J., Vodovotz, Y., Nims,

R., Christodoulou, D., Miles, A., Grisham, M. & Wink, D. (1996). Convenient

colorimetric and fluorometric assays for S-nitrosothiols. Anal.Biochem. 238, 150–

158.

Cook-Mills, J. & Deem, T. (2005). Active participation of endothelial cells in inflamma-

tion. J.Leukoc.Biol. 77, 487–495.

Cooke, J. P., Singer, A. H., Tsao, P., Zera, P., Rowan, R. A. & Billingham, M. E. (1992).

Antiatherogenic effects of L-arginine in the hypercholesterolemic rabbit. J Clin In-

vest 90, 1168–1172.

Cowger, M. L. (1971). Mechanism of bilirubin toxicity on tissue culture cells: factors

that affect toxicity, reversibility by albumin, and comparison with other respiratory

poisons and surfactants. Biochem Med 5, 1–16.

Crane, B. R., Arvai, A. S., Gachhui, R., Wu, C., Ghosh, D. K., Getzoff, E. D., Stuehr, D. J.

& Tainer, J. A. (1997). The structure of nitric oxide synthase oxygenase domain and

inhibitor complexes. Science 278, 425–431.

Cui, Y., Knig, J., Leier, I., Buchholz, U. & Keppler, D. (2001). Hepatic uptake of bilirubin

and its conjugates by the human organic anion transporter SLC21A6. J Biol Chem

276, 9626–9630.

Cybulsky, M., Fries, J., Williams, A., Sultan, P., Eddy, R., Byers, M., Shows, T.,

Gimbrone, M.A., J. & Collins, T. (1991). Gene structure, chromosomal lo-

cation, and basis for alternative mRNA splicing of the human VCAM1 gene.


Czernobilsky, B. & Dubin, I. N. (1965). Effect of fibroblasts, Chang and rat liver cells on

bilirubin in tissue culture. Proc Soc Exp Biol Med 119, 964–966.

Davies, M. J. & Woolf, N. (1993). Atherosclerosis: what is it and why does it occur? Br

Heart J 69, S3–11.

Davignon, J. & Ganz, P. (2004). Role of endothelial dysfunction in atherosclerosis. Cir-

culation 109, III27–III32.

Davis, K. L., Martin, E., Turko, I. V. & Murad, F. (2001). Novel effects of nitric oxide.

Annu Rev Pharmacol Toxicol 41, 203–236.

129

REFERENCES

Dawson, T. M., Steiner, J. P., Dawson, V. L., Dinerman, J. L., Uhl, G. R. & Snyder,

S. H. (1993). Immunosuppressant FK506 enhances phosphorylation of nitric oxide

synthase and protects against glutamate neurotoxicity. Proc Natl Acad Sci U S A

90, 9808–9812.

de Assis, M. C., Plotkowski, M. C., Fierro, I. M., Barja-Fidalgo, C. & de Freitas, M. S.

(2002). Expression of inducible nitric oxide synthase in human umbilical vein en-

dothelial cells during primary culture. Nitric Oxide 7, 254–261.

de Groot, R. P., den Hertog, J., Vandenheede, J. R., Goris, J. & Sassone-Corsi, P. (1993).

Multiple and cooperative phosphorylation events regulate the CREM activator func-

tion. EMBO J 12, 3903–3911.

Degitz, K., Li, L. & Caughman, S. (1991). Cloning and characterization of the 5’-

transcriptional regulatory region of the human intercellular adhesion molecule 1

gene. J.Biol.Chem. 266, 14024–14030.

Delhalle, S., Blasius, R., Dicato, M. & Diederich, M. (2004). A beginner’s guide to NF-

kappa B signaling pathways. Ann.N.Y.Acad.Sci. 1030, 1–13.

Diamond, M., Staunton, D., Marlin, S. & Springer, T. (1991). Binding of the integrin Mac-

1 (CD11b/CD18) to the third immunoglobulin-like domain of ICAM-1 (CD54) and

its regulation by glycosylation. Cell 65, 961–971.

Dignam, J., Lebovitz, R. & Roeder, R. (1983). Accurate transcription initiation by RNA

polymerase II in a soluble extract from isolated mammalian nuclei. Nucleic Acids

Res. 11, 1475–1489.

Dinerman, J. L., Dawson, T. M., Schell, M. J., Snowman, A. & Snyder, S. H. (1994).

Endothelial nitric oxide synthase localized to hippocampal pyramidal cells: impli-

cations for synaptic plasticity. Proc Natl Acad Sci U S A 91, 4214–4218.

Djouss, L., Levy, D., Cupples, L. A., Evans, J. C., D’Agostino, R. B. & Ellison, R. C.

(2001). Total serum bilirubin and risk of cardiovascular disease in the Framingham

offspring study. Am J Cardiol 87, 1196–200; A4, 7.

Dor, S., Takahashi, M., Ferris, C. D., Zakhary, R., Hester, L. D., Guastella, D. & Snyder,

S. H. (1999). Bilirubin, formed by activation of heme oxygenase-2, protects neurons

against oxidative stress injury. Proc Natl Acad Sci U S A 96, 2445–2450.

130

REFERENCES

Drews, R., Coffee, B., Prestwood, A. & McGraw, R. (1990). Gene sequence of porcine

tumor necrosis factor alpha . Nucleic Acids Res. 18, 5564–.

Drickamer, K. (1988). Two distinct classes of carbohydrate-recognition domains in animal

lectins. J.Biol.Chem. 263, 9557–9560.

Dustin, M., Rothlein, R., Bhan, A., Dinarello, C. & Springer, T. (1986). Induction by IL 1

and interferon- gamma : tissue distribution, biochemistry, and function of a natural

adherence molecule (ICAM-1). J.Immunol. 137, 245–254.

Eberhardt, W., Plss, C., Hummel, R. & Pfeilschifter, J. (1998). Molecular mechanisms

of inducible nitric oxide synthase gene expression by IL-1 beta and cAMP in rat

mesangial cells. J Immunol 160, 4961–4969.

Edelstein, L., Pan, A. & Collins, T. (2005). Chromatin modification and the endothelial-

specific activation of the E-selectin gene. J.Biol.Chem. 280, 11192–11202.

Elbirt, K. K. & Bonkovsky, H. L. (1999). Heme oxygenase: recent advances in under-

standing its regulation and role. Proc Assoc Am Physicians 111, 438–447.

Eliceiri, B. (2001). Integrin and growth factor receptor crosstalk. Circ.Res. 89, 1104–

1110.

Elizondo, G., Fernandez-Salguero, P., Sheikh, M. S., Kim, G. Y., Fornace, A. J., Lee,

K. S. & Gonzalez, F. J. (2000). Altered cell cycle control at the G(2)/M phases in

aryl hydrocarbon receptor-null embryo fibroblast. Mol Pharmacol 57, 1056–1063.

Emmanuel, C., Foo, E., Medbury, H., Matthews, J., Comis, A. & Zoellner, H. (2002).

Synergistic induction of apoptosis in human endothelial cells by tumour necrosis

factor- alpha and transforming growth factor- beta . Cytokine 18, 237–241.

Endemann, D. & Schiffrin, E. (2004). Endothelial dysfunction. J.Am.Soc.Nephrol. 15,

1983–1992.

Endres, M. & Laufs, U. (1998). [HMG-CoA reductase inhibitor and risk of stroke]. Ner-

venarzt 69, 717–721.

Engler, M. M., Engler, M. B., Malloy, M. J., Chiu, E. Y., Schloetter, M. C., Paul, S. M.,

Stuehlinger, M., Lin, K. Y., Cooke, J. P., Morrow, J. D., Ridker, P. M., Rifai, N.,

Miller, E., Witztum, J. L. & Mietus-Snyder, M. (2003). Antioxidant vitamins C

131

REFERENCES

and E improve endothelial function in children with hyperlipidemia: Endothelial

Assessment of Risk from Lipids in Youth (EARLY) Trial. Circulation 108, 1059–

1063.

Fecker, L., Eberle, J., Orfanos, C. & Geilen, C. (2002). Inducible nitric oxide synthase

is expressed in normal human melanocytes but not in melanoma cells in response to

tumor necrosis factor- alpha , interferon- gamma , and lipopolysaccharide. J.Invest

Dermatol. 118, 1019–1025.

Fernandes, A., Falcao, A., Silva, R., Gordo, A., Gama, M., Brito, M. & Brites, D. (2006).

Inflammatory signalling pathways involved in astroglial activation by unconjugated

bilirubin. J.Neurochem. 96, 1667–1679.

Feron, O., Belhassen, L., Kobzik, L., Smith, T. W., Kelly, R. A. & Michel, T. (1996).

Endothelial nitric oxide synthase targeting to caveolae. Specific interactions with

caveolin isoforms in cardiac myocytes and endothelial cells. J Biol Chem 271,

22810–22814.

Fiers, W. (1991). Tumor necrosis factor. Characterization at the molecular, cellular and in

vivo level. FEBS Lett. 285, 199–212.

Fischer, P., Dominguez, G., Cuniberti, L., Martinez, V., Werba, J., Ramirez, A. & Mas-

natta, L. (2003). Hyperhomocysteinemia induces renal hemodynamic dysfunction:

is nitric oxide involved? J.Am.Soc.Nephrol. 14, 653–660.

Forstermann, U., Boissel, J. & Kleinert, H. (1998). Expressional control of the ’constitu-

tive’ isoforms of nitric oxide synthase (NOS I and NOS III). FASEB J. 12, 773–790.

Frstermann, U. & Kleinert, H. (1995). Nitric oxide synthase: expression and expressional

control of the three isoforms. Naunyn Schmiedebergs Arch Pharmacol 352, 351–

364.

Frstermann, U., Pollock, J. S., Schmidt, H. H., Heller, M. & Murad, F. (1991).

Calmodulin-dependent endothelium-derived relaxing factor/nitric oxide synthase

activity is present in the particulate and cytosolic fractions of bovine aortic endothe-

lial cells. Proc Natl Acad Sci U S A 88, 1788–1792.

Fujita, T., Nolan, G. P., Ghosh, S. & Baltimore, D. (1992). Independent modes of tran-

scriptional activation by the p50 and p65 subunits of NF-kappa B. Genes Dev 6,

775–787.

132

REFERENCES

Fukumura, D. & Jain, R. K. (1998). Role of nitric oxide in angiogenesis and microcircu-

lation in tumors. Cancer Metastasis Rev 17, 77–89.

Galley, H. & Webster, N. (2004). Physiology of the endothelium. Br.J.Anaesth. 93, 105–

113.

Garca-Cardea, G., Oh, P., Liu, J., Schnitzer, J. E. & Sessa, W. C. (1996). Targeting of

nitric oxide synthase to endothelial cell caveolae via palmitoylation: implications

for nitric oxide signaling. Proc Natl Acad Sci U S A 93, 6448–6453.

Garlanda, C., Parravicini, C., Sironi, M., De Rossi, M., Wainstok, d. C., Carozzi, F., Bus-

solino, F., Colotta, F., Mantovani, A. & Vecchi, A. (1994). Progressive growth in

immunodeficient mice and host cell recruitment by mouse endothelial cells trans-

formed by polyoma middle-sized T antigen: implications for the pathogenesis of

opportunistic vascular tumors. Proc.Natl.Acad.Sci.U.S.A 91, 7291–7295.

Gaston, B., Singel, D., Doctor, A. & Stamler, J. S. (2006). S-nitrosothiol signaling in

respiratory biology. Am J Respir Crit Care Med 173, 1186–1193.

Genc, S., Genc, K., Kumral, A., Baskin, H. & Ozkan, H. (2003). Bilirubin is cytotoxic to

rat oligodendrocytes in vitro. Brain Res. 985, 135–141.

German, Z., Chambliss, K. L., Pace, M. C., Arnet, U. A., Lowenstein, C. J. & Shaul, P. W.

(2000). Molecular basis of cell-specific endothelial nitric-oxide synthase expression

in airway epithelium. J Biol Chem 275, 8183–8189.

Gerritsen, M., Williams, A., Neish, A., Moore, S., Shi, Y. & Collins, T.

(1997). CREB-binding protein/p300 are transcriptional coactivators of p65.


Ghosh, S. & Karin, M. (2002). Missing pieces in the NF- kappa B puzzle. Cell 109

Suppl, S81–S96.

Ghosh, S., May, M. J. & Kopp, E. B. (1998). NF- kappa B and Rel proteins: evolutionarily

conserved mediators of immune responses. Annu Rev Immunol 16, 225–260.

Gibbs, P. E. M. & Maines, M. D. (2007). Biliverdin inhibits activation of NF- kappa B:

reversal of inhibition by human biliverdin reductase. Int J Cancer 121, 2567–2574.

133

REFERENCES

Gimbrone, M. A., Cybulsky, M. I., Kume, N., Collins, T. & Resnick, N. (1995). Vascular

endothelium. An integrator of pathophysiological stimuli in atherogenesis. Ann N

Y Acad Sci 748, 122–31; discussion 131–2.

Gnanapandithen, K., Chen, Z., Kau, C. L., Gorczynski, R. M. & Marsden, P. A. (1996).

Cloning and characterization of murine endothelial constitutive nitric oxide syn-

thase. Biochim Biophys Acta 1308, 103–106.

Gourley, G. R. (1997). Bilirubin metabolism and kernicterus. Adv Pediatr 44, 173–229.

Govers, R. & Rabelink, T. (2001). Cellular regulation of endothelial nitric oxide synthase.

Am.J.Physiol Renal Physiol 280, F193–F206.

Govers, R., van der, S. P., van Donselaar, E., Slot, J. & Rabelink, T. (2002). Endothe-

lial nitric oxide synthase and its negative regulator caveolin-1 localize to distinct

perinuclear organelles. J.Histochem.Cytochem. 50, 779–788.

Green, L., Wagner, D., Glogowski, J., Skipper, P., Wishnok, J. & Tannenbaum, S. (1982).

Analysis of nitrate, nitrite, and [15N]nitrate in biological fluids. Anal.Biochem. 126,

131–138.

Greenberg, D. (2002). The jaundice of the cell. Proc.Natl.Acad.Sci.U.S.A 99, 15837–

15839.

Griffith, O. W. & Stuehr, D. J. (1995). Nitric oxide synthases: properties and catalytic

mechanism. Annu Rev Physiol 57, 707–736.

Griscavage, J. M., Fukuto, J. M., Komori, Y. & Ignarro, L. J. (1994). Nitric oxide inhibits

neuronal nitric oxide synthase by interacting with the heme prosthetic group. Role of

tetrahydrobiopterin in modulating the inhibitory action of nitric oxide. J Biol Chem

269, 21644–21649.

Griscavage, J. M., Rogers, N. E., Sherman, M. P. & Ignarro, L. J. (1993). Inducible nitric

oxide synthase from a rat alveolar macrophage cell line is inhibited by nitric oxide.

J Immunol 151, 6329–6337.

Grojean, S., Koziel, V., Vert, P. & Daval, J. L. (2000). Bilirubin induces apoptosis via

activation of NMDA receptors in developing rat brain neurons. Exp Neurol 166,

334–341.

134

REFERENCES

Gross, S. S. & Levi, R. (1992). Tetrahydrobiopterin synthesis. An absolute requirement

for cytokine-induced nitric oxide generation by vascular smooth muscle. J Biol

Chem 267, 25722–25729.

Grumbach, I., Chen, W., Mertens, S. & Harrison, D. (2005). A negative feedback mecha-

nism involving nitric oxide and nuclear factor kappa -B modulates endothelial nitric

oxide synthase transcription. J.Mol.Cell Cardiol. 39, 595–603.

Gullu, H., Erdogan, D., Tok, D., Topcu, S., Caliskan, M., Ulus, T. & Muderrisoglu, H.

(2005). High serum bilirubin concentrations preserve coronary flow reserve and

coronary microvascular functions. Arterioscler Thromb Vasc Biol 25, 2289–2294.

Hahne, M., Jager, U., Isenmann, S., Hallmann, R. & Vestweber, D. (1993). Five tu-

mor necrosis factor-inducible cell adhesion mechanisms on the surface of mouse

endothelioma cells mediate the binding of leukocytes. J.Cell Biol. 121, 655–664.

Hanada, T. & Yoshimura, A. (2002). Regulation of cytokine signaling and inflammation.

Cytokine Growth Factor Rev 13, 413–421.

Hansen, T. W. (2001). Bilirubin brain toxicity. J Perinatol 21 Suppl 1, S48–51; discussion

S59–62.

Harlan, J. M., Harker, L. A., Reidy, M. A., Gajdusek, C. M., Schwartz, S. M. & Striker,

G. E. (1983). Lipopolysaccharide-mediated bovine endothelial cell injury in vitro.

Lab Invest 48, 269–274.

Hashimoto, S., Gon, Y., Matsumoto, K., Takeshita, I. & Horie, T. (2001). N-

acetylcysteine attenuates TNF- alpha -induced p38 MAP kinase activation and p38

MAP kinase-mediated IL-8 production by human pulmonary vascular endothelial

cells. Br.J.Pharmacol. 132, 270–276.

Hauser, S., Ziurys, J. & Gollan, J. (1984). Subcellular distribution and regulation of

hepatic bilirubin UDP-glucuronyltransferase. J.Biol.Chem. 259, 4527–4533.

Hausladen, A., Privalle, C. T., Keng, T., DeAngelo, J. & Stamler, J. S. (1996). Nitrosative

stress: activation of the transcription factor OxyR. Cell 86, 719–729.

Hay, E. D. (1981). Extracellular matrix. J Cell Biol 91, 205s–223s.

135

REFERENCES

Hecker, M., Mlsch, A., Bassenge, E., Frstermann, U. & Busse, R. (1994). Subcellu-

lar localization and characterization of nitric oxide synthase(s) in endothelial cells:

physiological implications. Biochem J 299 ( Pt 1), 247–252.

Henkel, T., Machleidt, T., Alkalay, I., Krnke, M., Ben-Neriah, Y. & Baeuerle, P. A. (1993).

Rapid proteolysis of I kappa B- alpha is necessary for activation of transcription

factor NF- kappa B. Nature 365, 182–185.

Hensley, K., Robinson, K. A., Gabbita, S. P., Salsman, S. & Floyd, R. A. (2000). Reactive

oxygen species, cell signaling, and cell injury. Free Radic Biol Med 28, 1456–1462.

Hibbs, J. B., Taintor, R. R., Vavrin, Z. & Rachlin, E. M. (1988). Nitric oxide: a cytotoxic

activated macrophage effector molecule. Biochem Biophys Res Commun 157, 87–

94.

Hobbs, A. J., Higgs, A. & Moncada, S. (1999). Inhibition of nitric oxide synthase as a

potential therapeutic target. Annu Rev Pharmacol Toxicol 39, 191–220.

Hogan, P., Chen, L., Nardone, J. & Rao, A. (2003). Transcriptional regulation by calcium,

calcineurin, and NFAT. Genes Dev. 17, 2205–2232.

Hogg, N., Bates, P. A. & Harvey, J. (1991). Structure and function of intercellular adhe-

sion molecule-1. Chem Immunol 50, 98–115.

Holness, C. & Simmons, D. (1994). Structural motifs for recognition and adhesion in

members of the immunoglobulin superfamily. J.Cell Sci. 107 ( Pt 8), 2065–2070.

Hood, J. D., Meininger, C. J., Ziche, M. & Granger, H. J. (1998). VEGF upregulates

ecNOS message, protein, and NO production in human endothelial cells. Am J

Physiol 274, H1054–H1058.

Hopkins, P. N., Wu, L. L., Hunt, S. C., James, B. C., Vincent, G. M. & Williams, R. R.

(1996). Higher serum bilirubin is associated with decreased risk for early familial

coronary artery disease. Arterioscler Thromb Vasc Biol 16, 250–255.

Hu, B. & E., B. (1970). Methods in Enzymatic Analyse, vol. 2,. Second edition,

Weinheim-Bergsts.

Huang, W., Zhang, J. & Moore, D. (2004). A traditional herbal medicine enhances biliru-

bin clearance by activating the nuclear receptor CAR. J.Clin.Invest 113, 137–143.

136

REFERENCES

Humphries, M. (1990). The molecular basis and specificity of integrin-ligand interactions.

J.Cell Sci. 97 ( Pt 4), 585–592.

Hynes, R. O. (1987). Integrins: a family of cell surface receptors. Cell 48, 549–554.

Inoue, J., Kerr, L. D., Ransone, L. J., Bengal, E., Hunter, T. & Verma, I. M. (1991). c-rel

activates but v-rel suppresses transcription from kappa B sites. Proc Natl Acad Sci

U S A 88, 3715–3719.

Invernici, G., Ponti, D., Corsini, E., Cristini, S., Frigerio, S., Colombo, A., Parati, E. &

Alessandri, G. (2005). Human microvascular endothelial cells from different fetal

organs demonstrate organ-specific CAM expression. Exp.Cell Res. 308, 273–282.

Ishizawa, S., Yoshida, T. & Kikuchi, G. (1983). Induction of heme oxygenase in rat liver.

Increase of the specific mRNA by treatment with various chemicals and immuno-

logical identity of the enzymes in various tissues as well as the induced enzymes. J

Biol Chem 258, 4220–4225.

Jackson, D. (2002). alpha 4 integrin antagonists. Curr.Pharm.Des 8, 1229–1253.

Jacobsen, J. & Wennberg, R. P. (1974). Determination of unbound bilirubin in the serum

of newborns. Clin Chem 20, 783.

Jaffe, E., Nachman, R., Becker, C. & Minick, C. (1973). Culture of human endothelial

cells derived from umbilical veins. Identification by morphologic and immunologic

criteria. J.Clin.Invest 52, 2745–2756.

Jang, Y., Lincoff, A. M., Plow, E. F. & Topol, E. J. (1994). Cell adhesion molecules in

coronary artery disease. J Am Coll Cardiol 24, 1591–1601.

Jiang, F., Roberts, S. J., raju Datla, S. & Dusting, G. J. (2006). NO modulates NADPH

oxidase function via heme oxygenase-1 in human endothelial cells. Hypertension

48, 950–957.

Jiang, M., Tsukahara, H., Hayakawa, K., Todoroki, Y., Tamura, S., Ohshima, Y., Hiraoka,

M. & Mayumi, M. (2005). Effects of antioxidants and NO on TNF- alpha -induced

adhesion molecule expression in human pulmonary microvascular endothelial cells.

Respir.Med. 99, 580–591.

137

REFERENCES

Johnston, G. I., Cook, R. G. & McEver, R. P. (1989). Cloning of GMP-140, a gran-

ule membrane protein of platelets and endothelium: sequence similarity to proteins

involved in cell adhesion and inflammation. Cell 56, 1033–1044.

Juntavee, A., Sripa, B., Pugkhem, A., Khuntikeo, N. & Wongkham, S. (2005). Expres-

sion of sialyl Lewis(a) relates to poor prognosis in cholangiocarcinoma. World J

Gastroenterol 11, 249–254.

Kacimi, R., Long, C. & Karliner, J. (1997). Chronic hypoxia modulates the interleukin-1

beta -stimulated inducible nitric oxide synthase pathway in cardiac myocytes. Cir-

culation 96, 1937–1943.

Kamisako, T., Leier, I., Cui, Y., Knig, J., Buchholz, U., Hummel-Eisenbeiss, J. & Keppler,

D. (1999). Transport of monoglucuronosyl and bisglucuronosyl bilirubin by recom-

binant human and rat multidrug resistance protein 2. Hepatology 30, 485–490.

Karantzoulis-Fegaras, F., Antoniou, H., Lai, S. L., Kulkarni, G., D’Abreo, C., Wong,

G. K., Miller, T. L., Chan, Y., Atkins, J., Wang, Y. & Marsden, P. A. (1999). Char-

acterization of the human endothelial nitric-oxide synthase promoter. J Biol Chem

274, 3076–3093.

Kaszubska, W., Hooft, v. H., Ghersa, P., DeRaemy-Schenk, A., Chen, B., Hai, T., De-

Lamarter, J. & Whelan, J. (1993). Cyclic AMP-independent ATF family members

interact with NF- kappa B and function in the activation of the E-selectin promoter

in response to cytokines. Mol.Cell Biol. 13, 7180–7190.

Katagiri, K., Kinashi, T., Irie, S. & Katagiri, T. (1996). Differential regulation of leukocyte

function-associated antigen-1/ intercellular adhesion molecules-1-dependent adhe-

sion and aggregation in HL-60 cells. Blood 87, 4276–4285.

Kawamura, K., Ishikawa, K., Wada, Y., Kimura, S., Matsumoto, H., Kohro, T., Itabe, H.,

Kodama, T. & Maruyama, Y. (2005). Bilirubin from heme oxygenase-1 attenuates

vascular endothelial activation and dysfunction. Arterioscler.Thromb.Vasc.Biol. 25,

155–160.

Kelly, M., Hwang, J. & Kubes, P. (2007). Modulating leukocyte recruitment in inflamma-

tion. J.Allergy Clin.Immunol. 120, 3–10.

138

REFERENCES

Kempe, S., Kestler, H., Lasar, A. & Wirth, T. (2005). NF- kappa B controls the global

pro-inflammatory response in endothelial cells: evidence for the regulation of a pro-

atherogenic program. Nucleic Acids Res. 33, 5308–5319.

Keshavan, P., Deem, T., Schwemberger, S., Babcock, G., Cook-Mills, J. & Zucker, S.

(2005). Unconjugated bilirubin inhibits VCAM-1-mediated transendothelial leuko-

cyte migration. J.Immunol. 174, 3709–3718.

Keshavan, P., Schwemberger, S. J., Smith, D. L. H., Babcock, G. F. & Zucker, S. D.

(2004). Unconjugated bilirubin induces apoptosis in colon cancer cells by triggering

mitochondrial depolarization. Int J Cancer 112, 433–445.

Kleinert, H., Wallerath, T., Fritz, G., Ihrig-Biedert, I., Rodriguez-Pascual, F., Geller,

D. & Forstermann, U. (1998). Cytokine induction of NO synthase II in human

DLD-1 cells: roles of the JAK-STAT, AP-1 and NF- kappa B-signaling pathways.

Br.J.Pharmacol. 125, 193–201.

Kone, B. C. & Baylis, C. (1997). Biosynthesis and homeostatic roles of nitric oxide in the

normal kidney. Am J Physiol 272, F561–F578.

Koppenol, W. H., Moreno, J. J., Pryor, W. A., Ischiropoulos, H. & Beckman, J. S. (1992).

Peroxynitrite, a cloaked oxidant formed by nitric oxide and superoxide. Chem Res

Toxicol 5, 834–842.

Kuldo, J., Westra, J., Asgeirsdottir, S., Kok, R., Oosterhuis, K., Rots, M., Schouten, J.,

Limburg, P. & Molema, G. (2005). Differential effects of NF- kappa B and p38

MAPK inhibitors and combinations thereof on TNF- alpha - and IL-1 beta -induced

proinflammatory status of endothelial cells in vitro. Am.J.Physiol Cell Physiol 289,

C1229–C1239.

Kwok, R. P., Lundblad, J. R., Chrivia, J. C., Richards, J. P., Bchinger, H. P., Brennan,

R. G., Roberts, S. G., Green, M. R. & Goodman, R. H. (1994). Nuclear protein CBP

is a coactivator for the transcription factor CREB. Nature 370, 223–226.

Lai, P., Mohamed, F., Monge, J. & Stewart, D. (2003). Downregulation of eNOS mRNA

expression by TNF alpha : identification and functional characterization of RNA-

protein interactions in the 3’UTR. Cardiovasc.Res. 59, 160–168.

139

REFERENCES

Lamas, S., Marsden, P. A., Li, G. K., Tempst, P. & Michel, T. (1992). Endothelial ni-

tric oxide synthase: molecular cloning and characterization of a distinct constitutive

enzyme isoform. Proc Natl Acad Sci U S A 89, 6348–6352.

Landmesser, U., Harrison, D. & Drexler, H. (2006). Oxidant stress-a major

cause of reduced endothelial nitric oxide availability in cardiovascular disease.

Eur.J.Clin.Pharmacol. 62 Suppl 13, 13–19.

Larsen, G., Sako, D., Ahern, T., Shaffer, M., Erban, J., Sajer, S., Gibson, R., Wagner,

D., Furie, B. & Furie, B. (1992). P-selectin and E-selectin. Distinct but overlapping

leukocyte ligand specificities. J.Biol.Chem. 267, 11104–11110.

Laumonnier, Y., Nadaud, S., Agrapart, M. & Soubrier, F. (2000). Characterization of

an upstream enhancer region in the promoter of the human endothelial nitric-oxide

synthase gene. J Biol Chem 275, 40732–40741.

Lee, J. Y., Je, J. H., Jung, K. J., Yu, B. P. & Chung, H. Y. (2004). Induction of endothelial

iNOS by 4-hydroxyhexenal through NF- kappa B activation. Free Radic Biol Med

37, 539–548.

Leone, A. M., Palmer, R. M., Knowles, R. G., Francis, P. L., Ashton, D. S. & Moncada,

S. (1991). Constitutive and inducible nitric oxide synthases incorporate molecular

oxygen into both nitric oxide and citrulline. J Biol Chem 266, 23790–23795.

Levinson, S. S. (1997). Relationship between bilirubin, apolipoprotein B, and coronary

artery disease. Ann Clin Lab Sci 27, 185–192.

Li, H., Cybulsky, M., Gimbrone, M.A., J. & Libby, P. (1993). Inducible expression of vas-

cular cell adhesion molecule-1 by vascular smooth muscle cells in vitro and within

rabbit atheroma. Am.J.Pathol. 143, 1551–1559.

Li, J.-M., Mullen, A. M., Yun, S., Wientjes, F., Brouns, G. Y., Thrasher, A. J. & Shah,

A. M. (2002). Essential role of the NADPH oxidase subunit p47(phox) in endothelial

cell superoxide production in response to phorbol ester and tumor necrosis factor-

alpha. Circ Res 90, 143–150.

Li, X., Xing, D., Wang, J., Zhu, D.-B., Zhang, L., Chen, X.-J., Sun, F.-Y. & Hong, A.

(2006). Effects of I kappa B alpha and its mutants on NF- kappa B and p53 signaling

pathways. World J Gastroenterol 12, 6658–6664.

140

REFERENCES

Libby, P. (2002). Inflammation in atherosclerosis. Nature 420, 868–874.

Libby, P. & Aikawa, M. (2001). Evolution and stabilization of vulnerable atherosclerotic

plaques. Jpn.Circ.J. 65, 473–479.

Libby, P., Ridker, P. & Maseri, A. (2002). Inflammation and atherosclerosis. Circulation

105, 1135–1143.

Lin, C., Chen, L., Lee, P., Lee, C., Lin, J. & Chiu, J. (2007). The inhibition of TNF-

alpha -induced E-selectin expression in endothelial cells via the JNK/NF- kappa B

pathways by highly N-acetylated chitooligosaccharides. Biomaterials 28, 1355–

1366.

Link, E., Kerr, L. D., Schreck, R., Zabel, U., Verma, I. & Baeuerle, P. A. (1992). Purified

I kappa B- beta is inactivated upon dephosphorylation. J Biol Chem 267, 239–246.

Liu, J., Garca-Cardea, G. & Sessa, W. C. (1995). Biosynthesis and palmitoylation of

endothelial nitric oxide synthase: mutagenesis of palmitoylation sites, cysteines-15

and/or -26, argues against depalmitoylation-induced translocation of the enzyme.

Biochemistry 34, 12333–12340.

Liu, J., Garca-Cardea, G. & Sessa, W. C. (1996). Palmitoylation of endothelial nitric oxide

synthase is necessary for optimal stimulated release of nitric oxide: implications for

caveolae localization. Biochemistry 35, 13277–13281.

Liu, Y., Peterson, D. A., Kimura, H. & Schubert, D. (1997). Mechanism of cellular

3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) reduction. J

Neurochem 69, 581–593.

Liu, Y., Zhu, B., Wang, X., Luo, L., Li, P., Paty, D. & Cynader, M. (2003). Bilirubin as

a potent antioxidant suppresses experimental autoimmune encephalomyelitis: im-

plications for the role of oxidative stress in the development of multiple sclerosis.

J.Neuroimmunol. 139, 27–35.

London, I., West, R., Shemin, D. & Rittenberg, D. (1950). On the origin of bile pigment

in normal man. J.Biol.Chem. 184, 351–358.

Lowenstein, C. J., Alley, E. W., Raval, P., Snowman, A. M., Snyder, S. H., Russell, S. W.

& Murphy, W. J. (1993). Macrophage nitric oxide synthase gene: two upstream

141

REFERENCES

regions mediate induction by interferon gamma and lipopolysaccharide. Proc Natl

Acad Sci U S A 90, 9730–9734.

Lowenstein, C. J. & Snyder, S. H. (1992). Nitric oxide, a novel biologic messenger. Cell

70, 705–707.

Lster, K. & Horstkorte, R. (2000). Enzymatic quantification of cell-matrix and cell-cell

adhesion. Micron 31, 41–53.

Maciag, T., Cerundolo, J., Ilsley, S., Kelley, P. & Forand, R. (1979). An endothelial cell

growth factor from bovine hypothalamus: identification and partial characterization.


Madamanchi, N., Vendrov, A. & Runge, M. (2005). Oxidative stress and vascular disease.

Arterioscler.Thromb.Vasc.Biol. 25, 29–38.

Madhavan, M., Wattigney, W. A., Srinivasan, S. R. & Berenson, G. S. (1997). Serum

bilirubin distribution and its relation to cardiovascular risk in children and young

adults. Atherosclerosis 131, 107–113.

Maines, M. D. (1997). The heme oxygenase system: a regulator of second messenger

gases. Annu Rev Pharmacol Toxicol 37, 517–554.

Malek, S., Chen, Y., Huxford, T. & Ghosh, G. (2001). I kappa B beta , but not I kappa

B alpha , functions as a classical cytoplasmic inhibitor of NF- kappa B dimers by

masking both NF- kappa B nuclear localization sequences in resting cells. J Biol

Chem 276, 45225–45235.

Mann, G. E., Yudilevich, D. L. & Sobrevia, L. (2003). Regulation of amino acid and

glucose transporters in endothelial and smooth muscle cells. Physiol Rev 83, 183–

252.

Marsden, P. A., Heng, H. H., Scherer, S. W., Stewart, R. J., Hall, A. V., Shi, X. M.,

Tsui, L. C. & Schappert, K. T. (1993). Structure and chromosomal localization of

the human constitutive endothelial nitric oxide synthase gene. J Biol Chem 268,

17478–17488.

Marshall, H. E., Merchant, K. & Stamler, J. S. (2000). Nitrosation and oxidation in the

regulation of gene expression. FASEB J 14, 1889–1900.

142

REFERENCES

Martin, R. D., Hoeth, M., Hofer-Warbinek, R. & Schmid, J. A. (2000). The transcription

factor NF- kappa B and the regulation of vascular cell function. Arterioscler Thromb

Vasc Biol 20, E83–E88.

Marui, N., Offermann, M., Swerlick, R., Kunsch, C., Rosen, C., Ahmad, M., Alexander,

R. & Medford, R. (1993). Vascular cell adhesion molecule-1 (VCAM-1) gene tran-

scription and expression are regulated through an antioxidant-sensitive mechanism

in human vascular endothelial cells. J.Clin.Invest 92, 1866–1874.

May, M. & Ghosh, S. (1998). Signal transduction through NF- kappa B. Immunol.Today

19, 80–88.

Mayr, B., Canettieri, G. & Montminy, M. (2001). Distinct effects of cAMP and mito-

genic signals on CREB-binding protein recruitment impart specificity to target gene

activation via CREB. Proc.Natl.Acad.Sci.U.S.A 98, 10936–10941.

Mayr, B. & Montminy, M. (2001). Transcriptional regulation by the phosphorylation-

dependent factor CREB. Nat Rev Mol Cell Biol 2, 599–609.

McCoubrey, W. K., Huang, T. J. & Maines, M. D. (1997). Isolation and characterization

of a cDNA from the rat brain that encodes hemoprotein heme oxygenase-3. Eur J

Biochem 247, 725–732.

McDonagh, A. & Assisi, F. (1972). The ready isomerization of bilirubin IX- in aqueous

solution. Biochem.J. 129, 797–800.

McEver, R. P., Beckstead, J. H., Moore, K. L., Marshall-Carlson, L. & Bainton, D. F.

(1989). GMP-140, a platelet alpha -granule membrane protein, is also synthesized

by vascular endothelial cells and is localized in Weibel-Palade bodies. J Clin Invest

84, 92–99.

McGraw, R., Coffee, B., Otto, C., Drews, R. & Rawlings, C. (1990). Gene sequence of

feline tumor necrosis factor alpha . Nucleic Acids Res. 18, 5563–.

Michel, T., Li, G. K. & Busconi, L. (1993). Phosphorylation and subcellular translocation

of endothelial nitric oxide synthase. Proc Natl Acad Sci U S A 90, 6252–6256.

Minami, T., Miura, M., Aird, W. & Kodama, T. (2006). Thrombin-induced auto-inhibitory

factor, down syndrome critical region-1, attenuates NFAT-dependent vascular cell

143

REFERENCES

adhesion molecule-1 expression and inflammation in endothelium. J.Biol.Chem.

281, 20503–20520.

Mireles, L. C., Lum, M. A. & Dennery, P. A. (1999). Antioxidant and cytotoxic effects of

bilirubin on neonatal erythrocytes. Pediatr Res 45, 355–362.

Miyamoto, S., Maki, M., Schmitt, M. J., Hatanaka, M. & Verma, I. M. (1994). Tumor

necrosis factor alpha -induced phosphorylation of I kappa B alpha is a signal for its

degradation but not dissociation from NF- kappa B. Proc Natl Acad Sci U S A 91,

12740–12744.

Moncada, S. & Higgs, A. (1993). The L-arginine-nitric oxide pathway. N Engl J Med

329, 2002–2012.

Moncada, S., Palmer, R. M. & Higgs, E. A. (1991). Nitric oxide: physiology, pathophys-

iology, and pharmacology. Pharmacol Rev 43, 109–142.

Moreau, R. (2002). Are nitric oxide synthases new players in the pathophysiology of

fulminant hepatic failure? J.Hepatol. 37, 678–680.

Mosmann, T. (1983). Rapid colorimetric assay for cellular growth and survival: applica-

tion to proliferation and cytotoxicity assays. J Immunol Methods 65, 55–63.

Muller, S., Kammerbauer, C., Simons, U., Shibagaki, N., Li, L., Caughman, S. & Degitz,

K. (1995). Transcriptional regulation of intercellular adhesion molecule-1: PMA-

induction is mediated by NF kappa B. J.Invest Dermatol. 104, 970–975.

Munro, J., Lo, S., Corless, C., Robertson, M., Lee, N., Barnhill, R., Weinberg, D. &

Bevilacqua, M. (1992). Expression of sialyl-Lewis X, an E-selectin ligand, in inflam-

mation, immune processes, and lymphoid tissues. Am.J.Pathol. 141, 1397–1408.

Muoz, C., Pascual-Salcedo, D., Castellanos, M. C., Alfranca, A., Aragons, J., Vara, A.,

Redondo, J. M. & de Landzuri, M. O. (1996). Pyrrolidine dithiocarbamate inhibits

the production of interleukin-6, interleukin-8, and granulocyte-macrophage colony-

stimulating factor by human endothelial cells in response to inflammatory mediators:

modulation of NF- kappa B and AP-1 transcription factors activity. Blood 88, 3482–

3490.

Murray, C. J. & Lopez, A. D. (1997). Global mortality, disability, and the contribution of

risk factors: Global Burden of Disease Study. Lancet 349, 1436–1442.

144

REFERENCES

Mustafa, M. G., Cowger, M. L. & King, T. E. (1969). Effects of bilirubin on mitochondrial

reactions. J Biol Chem 244, 6403–6414.

Nakagami, T., Toyomura, K., Kinoshita, T. & Morisawa, S. (1993). A beneficial role

of bile pigments as an endogenous tissue protector: anti-complement effects of

biliverdin and conjugated bilirubin. Biochim Biophys Acta 1158, 189–193.

Nathan, C. (1992). Nitric oxide as a secretory product of mammalian cells. FASEB J 6,

3051–3064.

Nathan, C. (2003). Specificity of a third kind: reactive oxygen and nitrogen intermediates

in cell signaling. J Clin Invest 111, 769–778.

Nathan, C. & Sporn, M. (1991). Cytokines in context. J Cell Biol 113, 981–986.

Nathan, C. & Xie, Q. W. (1994). Regulation of biosynthesis of nitric oxide. J Biol Chem

269, 13725–13728.

Neish, A., Williams, A., Palmer, H., Whitley, M. & Collins, T. (1992). Functional analysis

of the human vascular cell adhesion molecule 1 promoter. J.Exp.Med. 176, 1583–

1593.

Nelson, T., Jacobsen, J. & Wennberg, R. P. (1974). Effect of pH on the interaction of

bilirubin with albumin and tissue culture cells. Pediatr Res 8, 963–967.

Neufeld, A. & Liu, B. (2003). Comparison of the signal transduction pathways for the

induction of gene expression of nitric oxide synthase-2 in response to two different

stimuli. Nitric.Oxide. 8, 95–102.

Ngai, K. C. & Yeung, C. Y. (1999). Additive effect of tumor necrosis factor- alpha and

endotoxin on bilirubin cytotoxicity. Pediatr Res 45, 526–530.

Ngai, K. C., Yeung, C. Y. & Karlberg, J. (1998). Modification of the MTT method for the

study of bilirubin cytotoxicity. Acta Paediatr Jpn 40, 313–317.

Ngai, K. C., Yeung, C. Y. & Leung, C. S. (2000). Difference in susceptibilities of different

cell lines to bilirubin damage. J Paediatr Child Health 36, 51–55.

Nims, R., Cook, J., Krishna, M., Christodoulou, D., Poore, C., Miles, A., Grisham, M.

& Wink, D. (1996). Colorimetric assays for nitric oxide and nitrogen oxide species

145

REFERENCES

formed from nitric oxide stock solutions and donor compounds. Methods Enzymol.

268, 93–105.

Nithipatikom, K., Pratt, P. F. & Campbell, W. B. (1996). Nitro-L-arginine inteferes with

the cadmium reduction of nitrate/griess reaction method of measuring nitric oxide

production. Eur J Clin Chem Clin Biochem 34, 133–137.

Notter, M. F. & Kendig, J. W. (1986). Differential sensitivity of neural cells to bilirubin

toxicity. Exp Neurol 94, 670–682.

Nunokawa, Y., Ishida, N. & Tanaka, S. (1994). Promoter analysis of human inducible

nitric oxide synthase gene associated with cardiovascular homeostasis. Biochem

Biophys Res Commun 200, 802–807.

O’Brien, A. J., Young, H. M., Povey, J. M. & Furness, J. B. (1995). Nitric oxide syn-

thase is localized predominantly in the Golgi apparatus and cytoplasmic vesicles of

vascular endothelial cells. Histochem Cell Biol 103, 221–225.

O’Brien, T., Babcock, G., Cornelius, J., Dingeldein, M., Talaska, G., Warshawsky, D. &

Mitchell, K. (2000). A comparison of apoptosis and necrosis induced by hepatotox-

ins in HepG2 cells. Toxicol Appl Pharmacol 164, 280–290.

O’Brien, W., Heimann, T., Tsao, L., Seet, B., McFadden, G. & Taylor, J. (2001). Regula-

tion of nitric oxide synthase 2 in rabbit corneal cells. Invest Ophthalmol.Vis.Sci. 42,

713–719.

Ollinger, R., Bilban, M., Erat, A., Froio, A., McDaid, J., Tyagi, S., Csizmadia, E., Graa-

Souza, A. V., Liloia, A., Soares, M. P., Otterbein, L. E., Usheva, A., Yamashita, K.

& Bach, F. H. (2005). Bilirubin: a natural inhibitor of vascular smooth muscle cell

proliferation. Circulation 112, 1030–1039.

Ono, H., Ichiki, T., Ohtsubo, H., Fukuyama, K., Imayama, I., Iino, N., Masuda, S.,

Hashiguchi, Y., Takeshita, A. & Sunagawa, K. (2006). cAMP-response element-

binding protein mediates tumor necrosis factor- alpha -induced vascular cell adhe-

sion molecule-1 expression in endothelial cells. Hypertens.Res. 29, 39–47.

Orpana, A., Ranta, V., Mikkola, T., Viinikka, L. & Ylikorkala, O. (1997). Inducible nitric

oxide and prostacyclin productions are differently controlled by extracellular matrix

and cell density in human vascular endothelial cells. J.Cell Biochem. 64, 538–546.

146

REFERENCES

Orthner, C. L., Rodgers, G. M. & Fitzgerald, L. A. (1995). Pyrrolidine dithiocarbamate

abrogates tissue factor (TF) expression by endothelial cells: evidence implicating

nuclear factor- kappa B in TF induction by diverse agonists. Blood 86, 436–443.

Osborn, L., Hession, C., Tizard, R., Vassallo, C., Luhowskyj, S., Chi-Rosso, G. &

Lobb, R. (1989). Direct expression cloning of vascular cell adhesion molecule 1,

a cytokine-induced endothelial protein that binds to lymphocytes. Cell 59, 1203–

1211.

Osborn, L., Vassallo, C. & Benjamin, C. (1992). Activated endothelium binds lympho-

cytes through a novel binding site in the alternately spliced domain of vascular cell

adhesion molecule-1. J.Exp.Med. 176, 99–107.

Ostrow, J., Pascolo, L., Shapiro, S. & Tiribelli, C. (2003a). New concepts in bilirubin

encephalopathy. Eur.J.Clin.Invest 33, 988–997.

Ostrow, J., Pascolo, L. & Tiribelli, C. (2003b). Reassessment of the unbound concentra-

tions of unconjugated bilirubin in relation to neurotoxicity in vitro. Pediatr.Res. 54,

98–104.

Ostrow, J. D. (1986). Bile Pigments and Jaundice, vol. 4,. Marcel Dekker INC., 270

Madison Avenue, New York, New York.

Ostrow, J. D., Jandl, J. H. & Schmid, R. (1962). The formation of bilirubin from

hemoglobin in vivo. J Clin Invest 41, 1628–1637.

Ostrow, J. D. & Tiribelli, C. (2001a). Variation in UGT1A1 activity in Gilbert’s syndrome.

J Hepatol 34, 636–639.

Ostrow, J. D. & Tiribelli, C. (2001b). New concepts in bilirubin neurotoxicity and the need

for studies at clinically relevant bilirubin concentrations. J Hepatol 34, 467–470.

Ostrow, J. D. & Tiribelli, C. (2003). Bilirubin, a curse and a boon. Gut 52, 1668–1670.

Palmer, R. M., Ashton, D. S. & Moncada, S. (1988). Vascular endothelial cells synthesize

nitric oxide from L-arginine. Nature 333, 664–666.

Papapetropoulos, A., Garca-Cardea, G., Madri, J. A. & Sessa, W. C. (1997). Nitric oxide

production contributes to the angiogenic properties of vascular endothelial growth

factor in human endothelial cells. J Clin Invest 100, 3131–3139.

147

REFERENCES

Patterson, S. (2002). Posttranslational protein S-palmitoylation and the compartmental-

ization of signaling molecules in neurons. Biol.Res. 35, 139–150.

Pennica, D., Nedwin, G., Hayflick, J., Seeburg, P., Derynck, R., Palladino, M., Kohr,

W., Aggarwal, B. & Goeddel, D. (1984). Human tumour necrosis factor: precursor

structure, expression and homology to lymphotoxin. Nature 312, 724–729.

Petri, B. & Bixel, M. (2006). Molecular events during leukocyte diapedesis. FEBS J. 273,

4399–4407.

Pfaffl, M. (2001). A new mathematical model for relative quantification in real-time RT-

PCR. Nucleic Acids Res. 29, e45–.

Pfeilschifter, J., Eberhardt, W. & Beck, K. F. (2001). Regulation of gene expression by

nitric oxide. Pflugers Arch 442, 479–486.

Pfeilschifter, J. & Vosbeck, K. (1991). Transforming growth factor beta 2 inhibits inter-

leukin 1 beta - and tumour necrosis factor alpha -induction of nitric oxide synthase

in rat renal mesangial cells. Biochem Biophys Res Commun 175, 372–379.

Polte, T., Hemmerle, A., Berndt, G., Grosser, N., Abate, A. & Schrder, H. (2002). Atrial

natriuretic peptide reduces cyclosporin toxicity in renal cells: role of cGMP and

heme oxygenase-1. Free Radic Biol Med 32, 56–63.

Portal, D., Rosendorff, A. & Kieff, E. (2006). Epstein-Barr nuclear antigen leader protein

coactivates transcription through interaction with histone deacetylase 4. Proc Natl

Acad Sci U S A 103, 19278–19283.

Pratico, D. (2005). Antioxidants and endothelium protection. Atherosclerosis 181, 215–

224.

Quinlan, K., Naik, S., Cannon, G., Armstrong, C., Bunnett, N., Ansel, J. & Caughman,

S. (1999). Substance P activates coincident NF-AT- and NF- kappa B-dependent

adhesion molecule gene expression in microvascular endothelial cells through intra-

cellular calcium mobilization. J.Immunol. 163, 5656–5665.

Radomski, M. W., Palmer, R. M. & Moncada, S. (1987). The role of nitric oxide and

cGMP in platelet adhesion to vascular endothelium. Biochem Biophys Res Commun

148, 1482–1489.

148

REFERENCES

Raines, E. W. & Ross, R. (1993). Smooth muscle cells and the pathogenesis of the lesions

of atherosclerosis. Br Heart J 69, S30–S37.

Raines, E. W. & Ross, R. (1995). Biology of atherosclerotic plaque formation: possible

role of growth factors in lesion development and the potential impact of soy. J Nutr

125, 624S–630S.

Raitakari, M., Ilvonen, T., Ahotupa, M., Lehtimki, T., Harmoinen, A., Suominen, P., Elo,

J., Hartiala, J. & Raitakari, O. T. (2004). Weight reduction with very-low-caloric diet

and endothelial function in overweight adults: role of plasma glucose. Arterioscler

Thromb Vasc Biol 24, 124–128.

Rajashekhar, G., Grow, M., Willuweit, A., Patterson, C. E. & Clauss, M. (2007). Diver-

gent and convergent effects on gene expression and function in acute versus chronic

endothelial activation. Physiol Genomics 31, 104–113.

Rao, K. M. (2000). Molecular mechanisms regulating iNOS expression in various cell

types. J Toxicol Environ Health B Crit Rev 3, 27–58.

Read, M., Whitley, M., Gupta, S., Pierce, J., Best, J., Davis, R. & Collins, T. (1997). Tu-

mor necrosis factor alpha -induced E-selectin expression is activated by the nuclear

factor- kappa B and c-JUN N-terminal kinase/p38 mitogen-activated protein kinase

pathways. J.Biol.Chem. 272, 2753–2761.

Reiners, J. J. & Clift, R. E. (1999). Aryl hydrocarbon receptor regulation of ceramide-

induced apoptosis in murine hepatoma 1c1c7 cells. A function independent of aryl

hydrocarbon receptor nuclear translocator. J Biol Chem 274, 2502–2510.

Rice, G. & Bevilacqua, M. (1989). An inducible endothelial cell surface glycoprotein

mediates melanoma adhesion. Science 246, 1303–1306.

Rice, G., Munro, J. & Bevilacqua, M. (1990). Inducible cell adhesion molecule

110 (INCAM-110) is an endothelial receptor for lymphocytes. A CD11/CD18-

independent adhesion mechanism. J.Exp.Med. 171, 1369–1374.

Rice, N. R. & Ernst, M. K. (1993). In vivo control of NF- kappa B activation by I kappa

B alpha . EMBO J 12, 4685–4695.

Rigato, I., Ostrow, J. & Tiribelli, C. (2005). Bilirubin and the risk of common non-hepatic

diseases. Trends Mol.Med. 11, 277–283.

149

REFERENCES

Roca, L., Calligaris, S., Wennberg, R., Ahlfors, C., Malik, S., Ostrow, J. & Tiribelli, C.

(2006). Factors affecting the binding of bilirubin to serum albumins: validation and

application of the peroxidase method. Pediatr.Res. 60, 724–728.

Rodrigues, C., Sola, S., Brito, M., Brites, D. & Moura, J. (2002a). Bilirubin directly

disrupts membrane lipid polarity and fluidity, protein order, and redox status in rat

mitochondria. J.Hepatol. 36, 335–341.

Rodrigues, C., Sola, S., Silva, R. & Brites, D. (2002b). Aging confers different sensitivity

to the neurotoxic properties of unconjugated bilirubin. Pediatr.Res. 51, 112–118.

Ross, R. (1999). Atherosclerosis–an inflammatory disease. N Engl J Med 340, 115–126.

Rubbo, H., Trostchansky, A., Botti, H. & Batthyny, C. (2002). Interactions of nitric oxide

and peroxynitrite with low-density lipoprotein. Biol Chem 383, 547–552.

Rublevskaya, I. & Maines, M. D. (1994). Interaction of Fe-protoporphyrin IX and heme

analogues with purified recombinant heme oxygenase-2, the constitutive isozyme of

the brain and testes. J Biol Chem 269, 26390–26395.

Ryan, D., Nuccie, B., Abboud, C. & Winslow, J. (1991). Vascular cell adhesion molecule-

1 and the integrin VLA-4 mediate adhesion of human B cell precursors to cultured

bone marrow adherent cells. J.Clin.Invest 88, 995–1004.

Sakoda, T., Hirata, K., Kuroda, R., Miki, N., Suematsu, M., Kawashima, S. & Yokoyama,

M. (1995). Myristoylation of endothelial cell nitric oxide synthase is important for

extracellular release of nitric oxide. Mol Cell Biochem 152, 143–148.

Sase, K. & Michel, T. (1995). Expression of constitutive endothelial nitric oxide synthase

in human blood platelets. Life Sci 57, 2049–2055.

Saura, M., Martnez-Dalmau, R., Minty, A., Prez-Sala, D. & Lamas, S. (1996).

Interleukin-13 inhibits inducible nitric oxide synthase expression in human mesan-

gial cells. Biochem J 313 ( Pt 2), 641–646.

Sawa, Y., Sugimoto, Y., Ueki, T., Ishikawa, H., Sato, A., Nagato, T. & Yoshida, S. (2007).

Effects of TNF- alpha on Leukocyte Adhesion Molecule Expressions in Cultured

Human Lymphatic Endothelium. J.Histochem.Cytochem. 55, 721–733.

Schiff, D., Chan, G. & Poznansky, M. J. (1985). Bilirubin toxicity in neural cell lines

N115 and NBR10A. Pediatr Res 19, 908–911.

150

REFERENCES

Schillinger, M., Mlekusch, W., Haumer, M., Sabeti, S., Maca, T. & Minar, E. (2002). Re-

lation of small artery compliance and lipoprotein (a) in patients with atherosclerosis.

Am J Hypertens 15, 980–985.

Schoonbroodt, S. & Piette, J. (2000). Oxidative stress interference with the nuclear factor-

kappa B activation pathways. Biochem Pharmacol 60, 1075–1083.

Schreck, R., Meier, B., Mnnel, D. N., Drge, W. & Baeuerle, P. A. (1992). Dithiocarba-

mates as potent inhibitors of nuclear factor kappa B activation in intact cells. J Exp

Med 175, 1181–1194.

Schreck, R., Rieber, P. & Baeuerle, P. A. (1991). Reactive oxygen intermediates as ap-

parently widely used messengers in the activation of the NF- kappa B transcription

factor and HIV-1. EMBO J 10, 2247–2258.

Schreck, R., Zorbas, H., Winnacker, E. L. & Baeuerle, P. A. (1990). The NF- kappa B

transcription factor induces DNA bending which is modulated by its 65-kD subunit.

Nucleic Acids Res 18, 6497–6502.

Schubert, S., Neeman, I. & Resnick, N. (2002). A novel mechanism for the inhibition of

NF- kappa B activation in vascular endothelial cells by natural antioxidants. FASEB

J. 16, 1931–1933.

Schwartz, D., Mendonca, M., Schwartz, I., Xia, Y., Satriano, J., Wilson, C. & Blantz,

R. (1997). Inhibition of constitutive nitric oxide synthase (NOS) by nitric oxide

generated by inducible NOS after lipopolysaccharide administration provokes renal

dysfunction in rats. J.Clin.Invest 100, 439–448.

Schwenke, D. C. & Carew, T. E. (1989). Initiation of atherosclerotic lesions in cholesterol-

fed rabbits. II. Selective retention of LDL vs. selective increases in LDL permeability

in susceptible sites of arteries. Arteriosclerosis 9, 908–918.

Schwenke, D. C. & Zilversmit, D. B. (1989). The arterial barrier to lipoprotein influx in

the hypercholesterolemic rabbit. 1. Studies during the first two days after mild aortic

injury. Atherosclerosis 77, 91–103.

Schwertner, H., Jackson, W. & Tolan, G. (1994). Association of low serum concentration

of bilirubin with increased risk of coronary artery disease. Clin.Chem. 40, 18–23.

151

REFERENCES

Searles, C. D. (2006). Transcriptional and posttranscriptional regulation of endothelial

nitric oxide synthase expression. Am J Physiol Cell Physiol 291, C803–C816.

Sen, R. & Baltimore, D. (1986). Multiple nuclear factors interact with the immunoglobu-

lin enhancer sequences. Cell 46, 705–716.

Sessa, W. C., Garca-Cardea, G., Liu, J., Keh, A., Pollock, J. S., Bradley, J., Thiru, S.,

Braverman, I. M. & Desai, K. M. (1995). The Golgi association of endothelial nitric

oxide synthase is necessary for the efficient synthesis of nitric oxide. J Biol Chem

270, 17641–17644.

Seubert, J., Darmon, A., El Kadi, A., D’Souza, S. & Bend, J. (2002). Apoptosis in

murine hepatoma hepa 1c1c7 wild-type, C12, and C4 cells mediated by bilirubin.

Mol.Pharmacol. 62, 257–264.

Shapiro, S. (2003). Bilirubin toxicity in the developing nervous system. Pediatr.Neurol.

29, 410–421.

Shimabuku, R. & Nakamura, H. (1983). Drug-mediated displacement of bilirubin from

albumin in cultured cells. Jpn J Exp Med 53, 215–217.

Shimizu, Y., Newman, W., Tanaka, Y. & Shaw, S. (1992a). Lymphocyte interactions with

endothelial cells. Immunol.Today 13, 106–112.

Shimizu, Y., van Seventer, G. A., Ennis, E., Newman, W., Horgan, K. J. & Shaw, S.

(1992b). Crosslinking of the T cell-specific accessory molecules CD7 and CD28

modulates T cell adhesion. J Exp Med 175, 577–582.

Shirai, T., Yamaguchi, H., Ito, H., Todd, C. & Wallace, R. (1985). Cloning and expression

in Escherichia coli of the gene for human tumour necrosis factor. Nature 313, 803–

806.

Shizukuda, Y., Tang, S., Yokota, R. & Ware, J. A. (1999). Vascular endothelial growth

factor-induced endothelial cell migration and proliferation depend on a nitric oxide-

mediated decrease in protein kinase C delta activity. Circ Res 85, 247–256.

Sligh, J.E., J., Ballantyne, C., Rich, S., Hawkins, H., Smith, C., Bradley, A. & Beaudet,

A. (1993). Inflammatory and immune responses are impaired in mice deficient in

intercellular adhesion molecule 1. Proc.Natl.Acad.Sci.U.S.A 90, 8529–8533.

152

REFERENCES

Smith, P. K., Krohn, R. I., Hermanson, G. T., Mallia, A. K., Gartner, F. H., Provenzano,

M. D., Fujimoto, E. K., Goeke, N. M., Olson, B. J. & Klenk, D. C. (1985). Mea-

surement of protein using bicinchoninic acid. Anal Biochem 150, 76–85.

Soares, M. P., Seldon, M. P., Gregoire, I. P., Vassilevskaia, T., Berberat, P. O., Yu, J.,

Tsui, T.-Y. & Bach, F. H. (2004). Heme oxygenase-1 modulates the expression of

adhesion molecules associated with endothelial cell activation. J Immunol 172,

3553–3563.

Springer, T. A. (1990). Adhesion receptors of the immune system. Nature 346, 425–434.

Stanley, P. & Hogg, N. (1998). The I domain of integrin LFA-1 interacts with ICAM-1

domain 1 at residue Glu-34 but not Gln-73. J.Biol.Chem. 273, 3358–3362.

Stary, H. C., Chandler, A. B., Dinsmore, R. E., Fuster, V., Glagov, S., Insull, W., Rosen-

feld, M. E., Schwartz, C. J., Wagner, W. D. & Wissler, R. W. (1995). A definition

of advanced types of atherosclerotic lesions and a histological classification of ath-

erosclerosis. A report from the Committee on Vascular Lesions of the Council on

Arteriosclerosis, American Heart Association. Arterioscler Thromb Vasc Biol 15,

1512–1531.

Stary, H. C., Chandler, A. B., Glagov, S., Guyton, J. R., Insull, W., Rosenfeld, M. E.,

Schaffer, S. A., Schwartz, C. J., Wagner, W. D. & Wissler, R. W. (1994). A definition

of initial, fatty streak, and intermediate lesions of atherosclerosis. A report from the

Committee on Vascular Lesions of the Council on Arteriosclerosis, American Heart

Association. Arterioscler Thromb 14, 840–856.

Staunton, D., Dustin, M., Erickson, H. & Springer, T. (1990). The arrangement of the

immunoglobulin-like domains of ICAM-1 and the binding sites for LFA-1 and rhi-

novirus. Cell 61, 243–254.

Staunton, D., Dustin, M. & Springer, T. (1989). Functional cloning of ICAM-2, a cell

adhesion ligand for LFA-1 homologous to ICAM-1. Nature 339, 61–64.

Stocker, R. & Keaney, J.F., J. (2004). Role of oxidative modifications in atherosclerosis.

Physiol Rev 84, 1381–1478.

Stocker, R. & Peterhans, E. (1989). Antioxidant properties of conjugated biliru-

bin and biliverdin: biologically relevant scavenging of hypochlorous acid. Free

Radic.Res.Commun. 6, 57–66.

153

REFERENCES

Stocker, R., Yamamoto, Y., McDonagh, A., Glazer, A. & Ames, B. (1987). Bilirubin is

an antioxidant of possible physiological importance. Science 235, 1043–1046.

Stroes, E. S., van Faassen, E. E., van Londen, G. J. & Rabelink, T. J. (1998). Oxygen

radical stress in vascular disease: the role of endothelial nitric oxide synthase. J

Cardiovasc Pharmacol 32 Suppl 3, S14–S21.

Stuehr, D., Pou, S. & Rosen, G. M. (2001). Oxygen reduction by nitric-oxide synthases.

J Biol Chem 276, 14533–14536.

Stuehr, D. J. & Griffith, O. W. (1992). Mammalian nitric oxide synthases. Adv Enzymol

Relat Areas Mol Biol 65, 287–346.

Szmitko, P. E., Wang, C.-H., Weisel, R. D., de Almeida, J. R., Anderson, T. J. & Verma,

S. (2003a). New markers of inflammation and endothelial cell activation: Part I.

Circulation 108, 1917–1923.

Szmitko, P. E., Wang, C.-H., Weisel, R. D., Jeffries, G. A., Anderson, T. J. & Verma, S.

(2003b). Biomarkers of vascular disease linking inflammation to endothelial activa-

tion: Part II. Circulation 108, 2041–2048.

Szotowski, B., Antoniak, S., Goldin-Lang, P., Tran, Q., Pels, K., Rosenthal, P., Bog-

danov, V., Borchert, H., Schultheiss, H. & Rauch, U. (2007). Antioxidative treatment

inhibits the release of thrombogenic tissue factor from irradiation- and cytokine-

induced endothelial cells. Cardiovasc.Res. 73, 806–812.

Taille, C., Almolki, A., Benhamed, M., Zedda, C., Megret, J., Berger, P., Leseche,

G., Fadel, E., Yamaguchi, T., Marthan, R., Aubier, M. & Boczkowski, J. (2003).

Heme oxygenase inhibits human airway smooth muscle proliferation via a bilirubin-

dependent modulation of ERK1/2 phosphorylation. J.Biol.Chem 278, 27160–

27168.

Takeichi, M. (1988). The cadherins: cell-cell adhesion molecules controlling animal mor-

phogenesis. Development 102, 639–655.

Tamada, S., Asai, T., Kuwabara, N., Iwai, T., Uchida, J., Teramoto, K., Kaneda, N.,

Yukimura, T., Komiya, T., Nakatani, T. & Miura, K. (2006). Molecular mechanisms

and therapeutic strategies of chronic renal injury: the role of nuclear factor kappa B

activation in the development of renal fibrosis. J Pharmacol Sci 100, 17–21.

154

REFERENCES

Tang, J. L., Zembowicz, A., Xu, X. M. & Wu, K. K. (1995). Role of Sp1 in transcrip-

tional activation of human nitric oxide synthase type III gene. Biochem Biophys Res

Commun 213, 673–680.

Tardif, J., Heinonen, T., Orloff, D. & Libby, P. (2006). Vascular biomarkers and surrogates

in cardiovascular disease. Circulation 113, 2936–2942.

Taylor, B. S., de Vera, M. E., Ganster, R. W., Wang, Q., Shapiro, R. A., Morris, S. M.,

Billiar, T. R. & Geller, D. A. (1998). Multiple NF- kappa B enhancer elements

regulate cytokine induction of the human inducible nitric oxide synthase gene. J

Biol Chem 273, 15148–15156.

Taylor, B. S. & Geller, D. A. (2000). Molecular regulation of the human inducible nitric

oxide synthase (iNOS) gene. Shock 13, 413–424.

Tedder, T., Steeber, D., Chen, A. & Engel, P. (1995). The selectins: vascular adhesion

molecules. FASEB J. 9, 866–873.

Teng, B., Murthy, K. S., Kuemmerle, J. F., Grider, J. R., Sase, K., Michel, T. & Makhlouf,

G. M. (1998). Expression of endothelial nitric oxide synthase in human and rabbit

gastrointestinal smooth muscle cells. Am J Physiol 275, G342–G351.

Tenhunen, R., Marver, H. & Schmid, R. (1968). The enzymatic conversion of heme to

bilirubin by microsomal heme oxygenase. Proc.Natl.Acad.Sci.U.S.A 61, 748–755.

Thaler, M. M. (1971). Bilirubin toxicity in hepatoma cells. Nat New Biol 230, 218–219.

Tichopad, A., Didier, A. & Pfaffl, M. W. (2004). Inhibition of real-time RT-PCR quantifi-

cation due to tissue-specific contaminants. Mol Cell Probes 18, 45–50.

Tomaro, M. & Batlle, A. (2002). Bilirubin: its role in cytoprotection against oxidative

stress. Int.J.Biochem.Cell Biol. 34, 216–220.

Traenckner, E. B., Wilk, S. & Baeuerle, P. A. (1994). A proteasome inhibitor prevents

activation of NF- kappa B and stabilizes a newly phosphorylated form of I kappa B-

alpha that is still bound to NF- kappa B. EMBO J 13, 5433–5441.

Urban, M. B., Schreck, R. & Baeuerle, P. A. (1991). NF- kappa B contacts DNA by a

heterodimer of the p50 and p65 subunit. EMBO J 10, 1817–1825.

155

REFERENCES

Van, Ostade, X., Tavernier, J., Prange, T. & Fiers, W. (1991). Localization of the active

site of human tumour necrosis factor (hTNF) by mutational analysis. EMBO J. 10,

827–836.

van Buul, J., Kanters, E. & Hordijk, P. (2007). Endothelial signaling by Ig-like cell

adhesion molecules. Arterioscler.Thromb.Vasc.Biol. 27, 1870–1876.

van de Stolpe, A. & van der Saag, P. T. (1996). Intercellular adhesion molecule-1. J Mol

Med 74, 13–33.

van der Wal, A., Becker, A., van der Loos, C. & Das, P. (1994). Site of intimal rupture

or erosion of thrombosed coronary atherosclerotic plaques is characterized by an

inflammatory process irrespective of the dominant plaque morphology. Circulation

89, 36–44.

Vaziri, N. D. & Wang, X. Q. (1999). cGMP-mediated negative-feedback regulation of

endothelial nitric oxide synthase expression by nitric oxide. Hypertension 34, 1237–

1241.

Venema, R. C., Nishida, K., Alexander, R. W., Harrison, D. G. & Murphy, T. J. (1994).

Organization of the bovine gene encoding the endothelial nitric oxide synthase.

Biochim Biophys Acta 1218, 413–420.

Verma, I., Stevenson, J., Schwarz, E., Van Antwerp, D. & Miyamoto, S. (1995). Rel/NF-

kappa B/I kappa B family: intimate tales of association and dissociation. Genes Dev.

9, 2723–2735.

Vestweber, D. & Blanks, J. (1999). Mechanisms that regulate the function of the selectins

and their ligands. Physiol Rev. 79, 181–213.

Vincent, S. R. & Hope, B. T. (1992). Neurons that say NO. Trends Neurosci 15, 108–113.

Vincent, S. R. & Kimura, H. (1992). Histochemical mapping of nitric oxide synthase in

the rat brain. Neuroscience 46, 755–784.

Virdis, A., Ghiadoni, L., Cardinal, H., Favilla, S., Duranti, P., Birindelli, R., Magagna,

A., Bernini, G., Salvetti, G., Taddei, S. & Salvetti, A. (2001). Mechanisms re-

sponsible for endothelial dysfunction induced by fasting hyperhomocystinemia in

normotensive subjects and patients with essential hypertension. J Am Coll Cardiol

38, 1106–1115.

156

REFERENCES

Vitek, L., Jirsa, M., Brodanova, M., Kalab, M., Marecek, Z., Danzig, V., Novotny, L. &

Kotal, P. (2002). Gilbert syndrome and ischemic heart disease: a protective effect of

elevated bilirubin levels. Atherosclerosis 160, 449–456.

Vodovotz, Y., Bogdan, C., Paik, J., Xie, Q. W. & Nathan, C. (1993). Mechanisms of

suppression of macrophage nitric oxide release by transforming growth factor beta .

J Exp Med 178, 605–613.

Vodovotz, Y., Kwon, N. S., Pospischil, M., Manning, J., Paik, J. & Nathan, C. (1994). In-

activation of nitric oxide synthase after prolonged incubation of mouse macrophages

with IFN- gamma and bacterial lipopolysaccharide. J Immunol 152, 4110–4118.

Voraberger, G., Schafer, R. & Stratowa, C. (1991). Cloning of the human gene for inter-

cellular adhesion molecule 1 and analysis of its 5’-regulatory region. Induction by

cytokines and phorbol ester. J.Immunol. 147, 2777–2786.

Wagner, D. (2005). New links between inflammation and thrombosis. Arte-

rioscler.Thromb.Vasc.Biol. 25, 1321–1324.

Wang, H.-D., Yamaya, M., Okinaga, S., Jia, Y.-X., Kamanaka, M., Takahashi, H., Guo,

L.-Y., Ohrui, T. & Sasaki, H. (2002). Bilirubin ameliorates bleomycin-induced pul-

monary fibrosis in rats. Am J Respir Crit Care Med 165, 406–411.

Wang, W., Smith, D. & Zucker, S. (2004). Bilirubin inhibits iNOS expression and NO

production in response to endotoxin in rats. Hepatology 40, 424–433.

Warnock, R., Askari, S., Butcher, E. & von Andrian, U. (1998). Molecular mechanisms

of lymphocyte homing to peripheral lymph nodes. J.Exp.Med. 187, 205–216.

Wei, P., Zhang, J., Egan-Hafley, M., Liang, S. & Moore, D. D. (2000). The nuclear

receptor CAR mediates specific xenobiotic induction of drug metabolism. Nature

407, 920–923.

Weisiger, R., Ostrow, J., Koehler, R., Webster, C., Mukerjee, P., Pascolo, L. & Tiribelli, C.

(2001). Affinity of human serum albumin for bilirubin varies with albumin concen-

tration and buffer composition: results of a novel ultrafiltration method. J.Biol.Chem

276, 29953–29960.

Wennberg, R. P., Ahlfors, C. E. & Rasmussen, L. F. (1979). The pathochemistry of

kernicterus. Early Hum Dev 3, 353–372.

157

REFERENCES

Wever, R., Luscher, T., Cosentino, F. & Rabelink, T. (1998). Atherosclerosis and the two

faces of endothelial nitric oxide synthase. Circulation 97, 108–112.

Whelan, J., Ghersa, P., Hooft, v. H., Gray, J., Chandra, G., Talabot, F. & DeLamarter, J.

(1991). An NF kappa B-like factor is essential but not sufficient for cytokine in-

duction of endothelial leukocyte adhesion molecule 1 (ELAM-1) gene transcription.

Nucleic Acids Res. 19, 2645–2653.

Wylie, D. E., Damsky, C. H. & Buck, C. A. (1979). Studies on the function of cell

surface glycoproteins. I. Use of antisera to surface membranes in the identification

of membrane components relevant to cell-substrate adhesion. J Cell Biol 80, 385–

402.

Xie, Q. & Nathan, C. (1994). The high-output nitric oxide pathway: role and regulation.

J Leukoc Biol 56, 576–582.

Xie, Q. W. & Nathan, C. (1993). Promoter of the mouse gene encoding calcium-

independent nitric oxide synthase confers inducibility by interferon- gamma and

bacterial lipopolysaccharide. Trans Assoc Am Physicians 106, 1–12.

Yang, B. & Rizzo, V. (2007). TNF- alpha potentiates protein-tyrosine nitration through

activation of NADPH oxidase and eNOS localized in membrane rafts and caveolae

of bovine aortic endothelial cells. Am J Physiol Heart Circ Physiol 292, H954–

H962.

Yoshizumi, M., Perrella, M. A., Burnett, J. C. & Lee, M. E. (1993). Tumor necrosis factor

downregulates an endothelial nitric oxide synthase mRNA by shortening its half-life.

Circ Res 73, 205–209.

Young, J., Libby, P. & Schonbeck, U. (2002). Cytokines in the pathogenesis of athero-

sclerosis. Thromb.Haemost. 88, 554–567.

Yu, Z., Zhang, W. & Kone, B. C. (2002a). Histone deacetylases augment cytokine induc-

tion of the iNOS gene. J Am Soc Nephrol 13, 2009–2017.

Yu, Z., Zhang, W. & Kone, B. C. (2002b). Signal transducers and activators of transcrip-

tion 3 (STAT3) inhibits transcription of the inducible nitric oxide synthase gene by

interacting with nuclear factor kappa B. Biochem J 367, 97–105.

158

REFERENCES

Zadeh, M. S., Kolb, J. P., Geromin, D., D’Anna, R., Boulmerka, A., Marconi, A., Dugas,

B., Marsac, C. & D’Alessio, P. (2000). Regulation of ICAM-1/CD54 expression on

human endothelial cells by hydrogen peroxide involves inducible NO synthase. J

Leukoc Biol 67, 327–334.

Zeiher, A. (1996). Endothelial vasodilator dysfunction: pathogenetic link to myocardial

ischaemia or epiphenomenon? Lancet 348 Suppl 1, s10–s12.

Zerfaoui, M., Suzuki, Y., Naura, A. S., Hans, C. P., Nichols, C. & Boulares, A. H. (2008).

Nuclear translocation of p65 NF- kappa B is sufficient for VCAM-1, but not ICAM-

1, expression in TNF-stimulated smooth muscle cells: Differential requirement for

PARP-1 expression and interaction. Cell Signal 20, 186–194.

Zernecke, A. & Weber, C. (2005). Inflammatory mediators in atherosclerotic vascular

disease. Basic Res Cardiol 100, 93–101.

Zhang, H., Chen, X., Teng, X., Snead, C. & Catravas, J. D. (1998). Molecular cloning

and analysis of the rat inducible nitric oxide synthase gene promoter in aortic smooth

muscle cells. Biochem Pharmacol 55, 1873–1880.

Zhang, J., Patel, J. M. & Block, E. R. (1997). Molecular cloning, characterization and ex-

pression of a nitric oxide synthase from porcine pulmonary artery endothelial cells.

Comp Biochem Physiol B Biochem Mol Biol 116, 485–491.

Zhang, Y. & Chen, F. (2004). Reactive oxygen species (ROS), troublemakers between

nuclear factor- kappa B (NF- kappa B) and c-Jun NH(2)-terminal kinase (JNK).

Cancer Res 64, 1902–1905.

Zhu, B., Carr, A. & Frei, B. (2002). Pyrrolidine dithiocarbamate is a potent antioxidant

against hypochlorous acid-induced protein damage. FEBS Lett. 532, 80–84.

Zimmermann, H., Kurzen, P., Klossner, W., Renner, E. L. & Marti, U. (1996). Decreased

constitutive hepatic nitric oxide synthase expression in secondary biliary fibrosis

and its changes after Roux-en-Y choledocho-jejunostomy in the rat. J Hepatol 25,

567–573.

Zucker, S., Goessling, W., Ransil, B. & Gollan, J. (1995). Influence of glutathione S-

transferase B (ligandin) on the intermembrane transfer of bilirubin. Implications for

the intracellular transport of nonsubstrate ligands in hepatocytes. J.Clin.Invest 96,

1927–1935.

159

REFERENCES

Zucker, S. D., Goessling, W. & Hoppin, A. G. (1999). Unconjugated bilirubin exhibits

spontaneous diffusion through model lipid bilayers and native hepatocyte mem-

branes. J Biol Chem 274, 10852–10862.

160

REPRINTS

161

Multidrug resistance associated protein 1 protects against bilirubin-inducedcytotoxicity

163

Reprints

164

Reprints

166

Unconjugated bilirubin prevents the TNF-α related induction of three en-dothelial adhesion molecules via the NF-κB pathway

169

UNIVERSITA DEGLI STUDI DI TRIESTE` - units.it · Universit`a degli Studi di Torino Dr. Claudio...

Documents

Transcript of UNIVERSITA DEGLI STUDI DI TRIESTE` - units.it · Universit`a degli Studi di Torino Dr. Claudio...